ID: 970314248

View in Genome Browser
Species Human (GRCh38)
Location 4:14814374-14814396
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
970314247_970314248 -6 Left 970314247 4:14814357-14814379 CCATAGTTAGCTAATATCTGAAT No data
Right 970314248 4:14814374-14814396 CTGAATTTACAGATAATCAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr