ID: 970316778

View in Genome Browser
Species Human (GRCh38)
Location 4:14835565-14835587
Sequence TAGACAGCTGGCTGGCTTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
970316778_970316781 0 Left 970316778 4:14835565-14835587 CCAGGAAGCCAGCCAGCTGTCTA No data
Right 970316781 4:14835588-14835610 TAATCAGATGTACAGAAGTCAGG No data
970316778_970316782 14 Left 970316778 4:14835565-14835587 CCAGGAAGCCAGCCAGCTGTCTA No data
Right 970316782 4:14835602-14835624 GAAGTCAGGTTAGCAGTAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
970316778 Original CRISPR TAGACAGCTGGCTGGCTTCC TGG (reversed) Intergenic
No off target data available for this crispr