ID: 970316780

View in Genome Browser
Species Human (GRCh38)
Location 4:14835577-14835599
Sequence TACATCTGATTATAGACAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
970316780_970316783 25 Left 970316780 4:14835577-14835599 CCAGCTGTCTATAATCAGATGTA No data
Right 970316783 4:14835625-14835647 TAATCTCTAGTCATTTGTCCAGG No data
970316780_970316782 2 Left 970316780 4:14835577-14835599 CCAGCTGTCTATAATCAGATGTA No data
Right 970316782 4:14835602-14835624 GAAGTCAGGTTAGCAGTAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
970316780 Original CRISPR TACATCTGATTATAGACAGC TGG (reversed) Intergenic
No off target data available for this crispr