ID: 970316781

View in Genome Browser
Species Human (GRCh38)
Location 4:14835588-14835610
Sequence TAATCAGATGTACAGAAGTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
970316776_970316781 14 Left 970316776 4:14835551-14835573 CCACAGTAACAAACCCAGGAAGC No data
Right 970316781 4:14835588-14835610 TAATCAGATGTACAGAAGTCAGG No data
970316774_970316781 21 Left 970316774 4:14835544-14835566 CCATCATCCACAGTAACAAACCC No data
Right 970316781 4:14835588-14835610 TAATCAGATGTACAGAAGTCAGG No data
970316777_970316781 1 Left 970316777 4:14835564-14835586 CCCAGGAAGCCAGCCAGCTGTCT No data
Right 970316781 4:14835588-14835610 TAATCAGATGTACAGAAGTCAGG No data
970316778_970316781 0 Left 970316778 4:14835565-14835587 CCAGGAAGCCAGCCAGCTGTCTA No data
Right 970316781 4:14835588-14835610 TAATCAGATGTACAGAAGTCAGG No data
970316773_970316781 26 Left 970316773 4:14835539-14835561 CCAATCCATCATCCACAGTAACA No data
Right 970316781 4:14835588-14835610 TAATCAGATGTACAGAAGTCAGG No data
970316779_970316781 -8 Left 970316779 4:14835573-14835595 CCAGCCAGCTGTCTATAATCAGA No data
Right 970316781 4:14835588-14835610 TAATCAGATGTACAGAAGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
970316781 Original CRISPR TAATCAGATGTACAGAAGTC AGG Intergenic
No off target data available for this crispr