ID: 970316782

View in Genome Browser
Species Human (GRCh38)
Location 4:14835602-14835624
Sequence GAAGTCAGGTTAGCAGTAAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
970316778_970316782 14 Left 970316778 4:14835565-14835587 CCAGGAAGCCAGCCAGCTGTCTA No data
Right 970316782 4:14835602-14835624 GAAGTCAGGTTAGCAGTAACTGG No data
970316779_970316782 6 Left 970316779 4:14835573-14835595 CCAGCCAGCTGTCTATAATCAGA No data
Right 970316782 4:14835602-14835624 GAAGTCAGGTTAGCAGTAACTGG No data
970316777_970316782 15 Left 970316777 4:14835564-14835586 CCCAGGAAGCCAGCCAGCTGTCT No data
Right 970316782 4:14835602-14835624 GAAGTCAGGTTAGCAGTAACTGG No data
970316776_970316782 28 Left 970316776 4:14835551-14835573 CCACAGTAACAAACCCAGGAAGC No data
Right 970316782 4:14835602-14835624 GAAGTCAGGTTAGCAGTAACTGG No data
970316780_970316782 2 Left 970316780 4:14835577-14835599 CCAGCTGTCTATAATCAGATGTA No data
Right 970316782 4:14835602-14835624 GAAGTCAGGTTAGCAGTAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
970316782 Original CRISPR GAAGTCAGGTTAGCAGTAAC TGG Intergenic
No off target data available for this crispr