ID: 970318854

View in Genome Browser
Species Human (GRCh38)
Location 4:14855951-14855973
Sequence GAGAACCAGGAGCAGTTGTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
970318847_970318854 22 Left 970318847 4:14855906-14855928 CCCCACTTGGCAAATCAGAAGAG No data
Right 970318854 4:14855951-14855973 GAGAACCAGGAGCAGTTGTCAGG No data
970318848_970318854 21 Left 970318848 4:14855907-14855929 CCCACTTGGCAAATCAGAAGAGG No data
Right 970318854 4:14855951-14855973 GAGAACCAGGAGCAGTTGTCAGG No data
970318850_970318854 20 Left 970318850 4:14855908-14855930 CCACTTGGCAAATCAGAAGAGGC No data
Right 970318854 4:14855951-14855973 GAGAACCAGGAGCAGTTGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
970318854 Original CRISPR GAGAACCAGGAGCAGTTGTC AGG Intergenic
No off target data available for this crispr