ID: 970320954

View in Genome Browser
Species Human (GRCh38)
Location 4:14874930-14874952
Sequence GTGAGAAATGCTATAACTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
970320948_970320954 24 Left 970320948 4:14874883-14874905 CCTAGTATGCAAGCCTCAGACAG No data
Right 970320954 4:14874930-14874952 GTGAGAAATGCTATAACTCCTGG No data
970320952_970320954 11 Left 970320952 4:14874896-14874918 CCTCAGACAGGAAGGTGGTGATG No data
Right 970320954 4:14874930-14874952 GTGAGAAATGCTATAACTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
970320954 Original CRISPR GTGAGAAATGCTATAACTCC TGG Intergenic
No off target data available for this crispr