ID: 970323640

View in Genome Browser
Species Human (GRCh38)
Location 4:14900506-14900528
Sequence GCTGACTTCTGAACTGGAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
970323640_970323644 5 Left 970323640 4:14900506-14900528 CCTTTTCCAGTTCAGAAGTCAGC No data
Right 970323644 4:14900534-14900556 CCCCTCAGGAGACAACATTTTGG No data
970323640_970323646 6 Left 970323640 4:14900506-14900528 CCTTTTCCAGTTCAGAAGTCAGC No data
Right 970323646 4:14900535-14900557 CCCTCAGGAGACAACATTTTGGG No data
970323640_970323642 -9 Left 970323640 4:14900506-14900528 CCTTTTCCAGTTCAGAAGTCAGC No data
Right 970323642 4:14900520-14900542 GAAGTCAGCAAAGTCCCCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
970323640 Original CRISPR GCTGACTTCTGAACTGGAAA AGG (reversed) Intergenic
No off target data available for this crispr