ID: 970324459

View in Genome Browser
Species Human (GRCh38)
Location 4:14909033-14909055
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
970324455_970324459 9 Left 970324455 4:14909001-14909023 CCTCAGGGATAACTCTAATTAAT No data
Right 970324459 4:14909033-14909055 TTCTCTGGGCCCCACCAGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr