ID: 970329526

View in Genome Browser
Species Human (GRCh38)
Location 4:14965245-14965267
Sequence AGACTCTTCTAGCCAACATC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
970329526_970329527 -4 Left 970329526 4:14965245-14965267 CCAGATGTTGGCTAGAAGAGTCT No data
Right 970329527 4:14965264-14965286 GTCTAGATGACGCACAGCATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
970329526 Original CRISPR AGACTCTTCTAGCCAACATC TGG (reversed) Intergenic
No off target data available for this crispr