ID: 970331223

View in Genome Browser
Species Human (GRCh38)
Location 4:14986392-14986414
Sequence GCAGATAAGGAGATTGAAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
970331223_970331231 8 Left 970331223 4:14986392-14986414 CCAGTTTCAATCTCCTTATCTGC No data
Right 970331231 4:14986423-14986445 CCCCATTCAGCCACCTGAGGGGG No data
970331223_970331228 6 Left 970331223 4:14986392-14986414 CCAGTTTCAATCTCCTTATCTGC No data
Right 970331228 4:14986421-14986443 TTCCCCATTCAGCCACCTGAGGG No data
970331223_970331229 7 Left 970331223 4:14986392-14986414 CCAGTTTCAATCTCCTTATCTGC No data
Right 970331229 4:14986422-14986444 TCCCCATTCAGCCACCTGAGGGG No data
970331223_970331227 5 Left 970331223 4:14986392-14986414 CCAGTTTCAATCTCCTTATCTGC No data
Right 970331227 4:14986420-14986442 ATTCCCCATTCAGCCACCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
970331223 Original CRISPR GCAGATAAGGAGATTGAAAC TGG (reversed) Intergenic
No off target data available for this crispr