ID: 970333319

View in Genome Browser
Species Human (GRCh38)
Location 4:15004756-15004778
Sequence CCTCCCCGCGTCGGGGGTCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 138
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 128}

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
970333319_970333334 4 Left 970333319 4:15004756-15004778 CCCGGACCCCCGACGCGGGGAGG 0: 1
1: 0
2: 1
3: 8
4: 128
Right 970333334 4:15004783-15004805 GCGAGGACCGGGGGCTGGCCGGG 0: 1
1: 0
2: 2
3: 18
4: 360
970333319_970333341 26 Left 970333319 4:15004756-15004778 CCCGGACCCCCGACGCGGGGAGG 0: 1
1: 0
2: 1
3: 8
4: 128
Right 970333341 4:15004805-15004827 GGGCCTCGGAAGAGCGGCCGTGG 0: 1
1: 0
2: 2
3: 19
4: 132
970333319_970333330 -6 Left 970333319 4:15004756-15004778 CCCGGACCCCCGACGCGGGGAGG 0: 1
1: 0
2: 1
3: 8
4: 128
Right 970333330 4:15004773-15004795 GGGAGGCGCGGCGAGGACCGGGG No data
970333319_970333339 20 Left 970333319 4:15004756-15004778 CCCGGACCCCCGACGCGGGGAGG 0: 1
1: 0
2: 1
3: 8
4: 128
Right 970333339 4:15004799-15004821 GGCCGGGGGCCTCGGAAGAGCGG 0: 1
1: 0
2: 1
3: 16
4: 238
970333319_970333338 12 Left 970333319 4:15004756-15004778 CCCGGACCCCCGACGCGGGGAGG 0: 1
1: 0
2: 1
3: 8
4: 128
Right 970333338 4:15004791-15004813 CGGGGGCTGGCCGGGGGCCTCGG 0: 1
1: 1
2: 4
3: 108
4: 770
970333319_970333342 27 Left 970333319 4:15004756-15004778 CCCGGACCCCCGACGCGGGGAGG 0: 1
1: 0
2: 1
3: 8
4: 128
Right 970333342 4:15004806-15004828 GGCCTCGGAAGAGCGGCCGTGGG No data
970333319_970333332 -1 Left 970333319 4:15004756-15004778 CCCGGACCCCCGACGCGGGGAGG 0: 1
1: 0
2: 1
3: 8
4: 128
Right 970333332 4:15004778-15004800 GCGCGGCGAGGACCGGGGGCTGG 0: 1
1: 0
2: 4
3: 36
4: 490
970333319_970333328 -8 Left 970333319 4:15004756-15004778 CCCGGACCCCCGACGCGGGGAGG 0: 1
1: 0
2: 1
3: 8
4: 128
Right 970333328 4:15004771-15004793 CGGGGAGGCGCGGCGAGGACCGG No data
970333319_970333336 6 Left 970333319 4:15004756-15004778 CCCGGACCCCCGACGCGGGGAGG 0: 1
1: 0
2: 1
3: 8
4: 128
Right 970333336 4:15004785-15004807 GAGGACCGGGGGCTGGCCGGGGG No data
970333319_970333331 -5 Left 970333319 4:15004756-15004778 CCCGGACCCCCGACGCGGGGAGG 0: 1
1: 0
2: 1
3: 8
4: 128
Right 970333331 4:15004774-15004796 GGAGGCGCGGCGAGGACCGGGGG 0: 1
1: 0
2: 1
3: 20
4: 287
970333319_970333335 5 Left 970333319 4:15004756-15004778 CCCGGACCCCCGACGCGGGGAGG 0: 1
1: 0
2: 1
3: 8
4: 128
Right 970333335 4:15004784-15004806 CGAGGACCGGGGGCTGGCCGGGG 0: 1
1: 0
2: 1
3: 17
4: 278
970333319_970333333 3 Left 970333319 4:15004756-15004778 CCCGGACCCCCGACGCGGGGAGG 0: 1
1: 0
2: 1
3: 8
4: 128
Right 970333333 4:15004782-15004804 GGCGAGGACCGGGGGCTGGCCGG No data
970333319_970333329 -7 Left 970333319 4:15004756-15004778 CCCGGACCCCCGACGCGGGGAGG 0: 1
1: 0
2: 1
3: 8
4: 128
Right 970333329 4:15004772-15004794 GGGGAGGCGCGGCGAGGACCGGG 0: 1
1: 0
2: 4
3: 84
4: 496

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
970333319 Original CRISPR CCTCCCCGCGTCGGGGGTCC GGG (reversed) Intronic
900109736 1:1000391-1000413 CCGCCCAGCCCCGGGGGTCCCGG - Intergenic
900112806 1:1015652-1015674 CCTGCCCCCGTTGGGGGTTCAGG - Intergenic
900422691 1:2562437-2562459 CCTCCCCGCATTGGAGGCCCCGG - Intronic
900502616 1:3013905-3013927 ACTCCCCGCCTTGGGGATCCAGG - Intergenic
901007756 1:6180017-6180039 CCTCCCCGCGCCGGGCATGCGGG - Exonic
901203084 1:7477685-7477707 CCTCCCCGCCTCTGGGGACTGGG + Intronic
903986930 1:27235074-27235096 CCTACCCGCCTCGGGGCCCCGGG + Intronic
904744470 1:32702630-32702652 CCCCGCCGCGCCGGGGCTCCGGG + Exonic
905137171 1:35808466-35808488 CCGCCCCGGGTCCCGGGTCCCGG - Intronic
906142285 1:43540821-43540843 CTTCCCTGGGTCAGGGGTCCTGG + Intronic
912305178 1:108560042-108560064 CCTCAGCGCCTCGGGGGTCGGGG - Intergenic
914900072 1:151707043-151707065 CCTCCCAGCTTTGGGGGTACAGG - Intronic
915218577 1:154356058-154356080 CCTCCCTGCGTGGGGAGCCCAGG - Intergenic
915463557 1:156082955-156082977 TCTCCCCGCGGCCGGGCTCCGGG - Intronic
916668223 1:166987191-166987213 CCTCCCCACCTCCGGGCTCCAGG + Intronic
919486810 1:198156929-198156951 CCACCCCGCGTCGTGAGTCCAGG - Intergenic
920378958 1:205524714-205524736 CCTCTCCGGCTAGGGGGTCCAGG + Intronic
1063664976 10:8055601-8055623 CCTCCCCGCGCGCGGGTTCCGGG + Exonic
1067145494 10:43690611-43690633 GCACCCAGAGTCGGGGGTCCAGG + Intergenic
1075564055 10:123490951-123490973 CCTCCCAGCCTCAGGGTTCCAGG - Intergenic
1076821548 10:132942363-132942385 CCTCCCCGGGGCGGGGGTCGTGG + Intronic
1076821567 10:132942398-132942420 CCTCCCCGGGGCGGGGGTCGTGG + Intronic
1077018322 11:406681-406703 GCTCCCCGCATCGGGGCCCCAGG + Intronic
1077453852 11:2666254-2666276 CTGCCCAGCCTCGGGGGTCCTGG - Intronic
1077635829 11:3840901-3840923 CCTCCCCGAGGCGGGGGAGCTGG + Exonic
1077709287 11:4519809-4519831 CCTCCCCGCTTCTGGGCTCTTGG + Intergenic
1080601866 11:33828967-33828989 CCGCCCCGCTGCGGGGCTCCAGG - Intergenic
1081831466 11:46119878-46119900 CCTCCCCCCGGCGGGGGCGCGGG + Intronic
1083579060 11:63813473-63813495 CCTCGGCGCGTCGGGAGCCCGGG - Exonic
1083656417 11:64231968-64231990 CCTCCCCACCTCAGGGGTACGGG - Intronic
1083901811 11:65646978-65647000 CCTCCCCGCGGCCGTGGTACAGG - Exonic
1089200782 11:116723670-116723692 CTTCCCCAGGTCGGGGGCCCAGG + Intergenic
1090627009 11:128616454-128616476 CCTCCCCTGGTCAGGGGGCCTGG - Intergenic
1091888097 12:4031317-4031339 CCTCCCCGCGCCCGGCGGCCCGG + Intergenic
1094375381 12:29783683-29783705 CCTCCCGGCGGCGGGGCTGCGGG - Exonic
1094476647 12:30845665-30845687 CCTCCCTGCTTCCCGGGTCCTGG - Intergenic
1096123514 12:49103804-49103826 CCTCCTCCCGTAGGGTGTCCTGG - Exonic
1102933961 12:116881651-116881673 GCTCCCCGCAGCGGAGGTCCTGG + Intergenic
1105011818 12:132761538-132761560 CCTCCTCGGGCCTGGGGTCCCGG - Intronic
1122842364 14:104472685-104472707 CCTCCGGGCGTCGGGTGTGCAGG - Intergenic
1123055692 14:105568588-105568610 ACTCCCCGGGTCAGGGCTCCAGG - Intergenic
1123080051 14:105688107-105688129 ACTCCCCGGGTCAGGGCTCCAGG - Intergenic
1128454185 15:67823445-67823467 CATCTCCGCGCCCGGGGTCCCGG + Intronic
1130894349 15:88158761-88158783 CCTCCCCGGGTGGTGGATCCCGG - Intronic
1131826022 15:96322958-96322980 CCTCCCCGCGTCGCGGCTCAGGG - Intergenic
1131827492 15:96332567-96332589 CCTTCCCTCGTCCTGGGTCCCGG + Intronic
1132147582 15:99437667-99437689 CCTCCCTGGGTCCTGGGTCCTGG - Intergenic
1132407765 15:101554669-101554691 CCTTCCCGGGGCGGGGTTCCAGG - Intergenic
1133241331 16:4416181-4416203 CTGCGCCGCCTCGGGGGTCCCGG + Intronic
1134007665 16:10828902-10828924 CCTCCCTGCGGCGGAGGGCCAGG - Intergenic
1136933485 16:34437786-34437808 CCTCCCGGCGTCCTGGCTCCGGG + Intergenic
1136971087 16:34974028-34974050 CCTCCCGGCGTCCTGGCTCCGGG - Intergenic
1141153869 16:81583298-81583320 CCCCCCGGGGTCGGGGCTCCGGG + Intronic
1142296929 16:89230284-89230306 CCTCCCCACGTGGGGGGTGGTGG - Exonic
1142600211 17:1050206-1050228 CCTCCCAGCTTCGGAGGTTCAGG - Intronic
1142757507 17:2024764-2024786 CCGCCCGGCGCCGGGGCTCCCGG - Intronic
1143183564 17:4998135-4998157 CCTCGGCGCGGCGGGGCTCCCGG - Exonic
1147975991 17:44248344-44248366 GTTCCCAGAGTCGGGGGTCCCGG - Intergenic
1151684888 17:75640541-75640563 CATCCCCGCGTTTGGGATCCCGG - Intronic
1152092462 17:78254535-78254557 CCGCCCTGGGCCGGGGGTCCAGG + Intergenic
1152438829 17:80292761-80292783 CCTCCTCACCTGGGGGGTCCTGG + Intronic
1152618013 17:81346555-81346577 TGGCCCCGCGTCGGGGGTGCGGG + Intergenic
1152689742 17:81712526-81712548 CCGCCCCGCGTCCCGGGCCCCGG - Intronic
1152748450 17:82051774-82051796 GCTCGCAGCGCCGGGGGTCCCGG - Exonic
1157805714 18:50656070-50656092 CCTCCTTGAGTCTGGGGTCCTGG - Intronic
1160769048 19:822131-822153 CCTCCCACCGCCGGGGGTCTCGG + Intergenic
1161041219 19:2111635-2111657 CCGCCCCACGCCGGGGTTCCTGG - Intronic
1161066615 19:2241680-2241702 CCTCCCCGCCTCGGGCTTCTTGG - Intronic
1161401090 19:4066490-4066512 CCTCCCCGCGCTCGGGATCCAGG + Intronic
1162498144 19:11034922-11034944 CCTCCTCGCGCCTGCGGTCCAGG - Exonic
1163154660 19:15433135-15433157 CATCTCCGAGTCGGGGATCCTGG + Intronic
1165080364 19:33302978-33303000 CCTCCCCGGGACGCGGGTCCGGG - Intergenic
1166855861 19:45782376-45782398 CCTCCCCGGGCCGGGGGCTCGGG + Intronic
1167755996 19:51414366-51414388 CCTCCCCTCTTCCTGGGTCCAGG + Intronic
1167792134 19:51689372-51689394 CCTCCCCGGCTCTGCGGTCCGGG - Intergenic
1168406587 19:56113675-56113697 CCTCCCTGCGTCCCGGTTCCTGG - Intronic
1168516929 19:57016678-57016700 CCACCCCGCGACGTGGGGCCCGG - Intergenic
924962524 2:46744-46766 TCACCTCGCGTCCGGGGTCCCGG + Intronic
925469220 2:4140777-4140799 CCTCCCCGTGACGAGGTTCCTGG - Intergenic
927143464 2:20145248-20145270 ATTCCCAGCGTCGGTGGTCCAGG - Intergenic
927684423 2:25160979-25161001 CCTCCCAGCCTGGGGGGTCGTGG - Exonic
933758940 2:85661425-85661447 CCTCCCCGCAACTGGGGGCCTGG + Intronic
935371886 2:102356004-102356026 CCTCCCTGACTCGGAGGTCCCGG - Exonic
1169214739 20:3786524-3786546 CCGCCCCGGGGCGGGGGGCCCGG + Exonic
1171011796 20:21513074-21513096 CCTCCCAGCGGCCGGAGTCCGGG + Intronic
1173548023 20:43914456-43914478 CCGCCCCGCGGCGTGGGTGCGGG - Intergenic
1175267246 20:57710109-57710131 CCTCCCCGAGCCGGGGGGCGGGG + Intronic
1175923094 20:62459075-62459097 CCTCGCAGCCTCGGGGGTGCCGG + Intergenic
1176121665 20:63456869-63456891 CCTCCCCGGGGCTGGGGACCTGG + Intronic
1176197614 20:63844612-63844634 CCTCCTCCCTTGGGGGGTCCTGG + Intergenic
1176545702 21:8197097-8197119 TCTCCCCGCCTCAGGGGTGCTGG + Intergenic
1176564653 21:8380142-8380164 TCTCCCCGCCTCAGGGGTGCTGG + Intergenic
1179133760 21:38661411-38661433 CCTCCCCACGACCGAGGTCCCGG - Intronic
1182360652 22:29744578-29744600 CATCCCAGCCTTGGGGGTCCAGG - Intronic
1184222513 22:43110095-43110117 CCCCCTCCCGTCGGGGCTCCGGG - Intergenic
1184257218 22:43294200-43294222 CCTCCCCTCCTCGGGGGCCGGGG - Intronic
1184754569 22:46508603-46508625 CCTCACCGCCTGGGGCGTCCAGG + Intronic
1203250573 22_KI270733v1_random:113334-113356 TCTCCCCGCCTCAGGGGTGCTGG + Intergenic
950450132 3:13060712-13060734 CCTGCCCCCGGCGGGGCTCCAGG + Intronic
951611274 3:24494897-24494919 CCTCCCGGCGGCGGGGTCCCGGG + Intronic
953350219 3:42209822-42209844 CCACACCGGGCCGGGGGTCCAGG - Exonic
954413615 3:50382105-50382127 CCGCCCCGAGTTGGGGGTCGAGG - Intronic
962816453 3:139005538-139005560 TCTCCGCGCGTGGGGAGTCCAGG - Exonic
968872811 4:3250228-3250250 ACTCCCAGCGTGGGGGCTCCCGG + Intronic
969295844 4:6270274-6270296 CCCGCCCGCGGCGGGGCTCCAGG - Intronic
970333319 4:15004756-15004778 CCTCCCCGCGTCGGGGGTCCGGG - Intronic
980063927 4:128161375-128161397 CCTCCCTGCCTCTGGGGTTCTGG - Intronic
985537578 5:473599-473621 CGTCCCCCCGCCGGGGGTCCCGG + Intronic
986184510 5:5423012-5423034 CCCCCCCGCGCCCGGGGCCCCGG - Intronic
991263448 5:64690689-64690711 CCTCGCCGCGCCGGGGGCACTGG - Exonic
997453989 5:134004517-134004539 CCTCCCCGCGGCCGGGCTGCCGG + Intronic
1005040713 6:21596883-21596905 CCTCCACGCCTCCGGGGTCTGGG - Exonic
1006770301 6:36547422-36547444 CGTCTCCGCGGCGGGGGACCGGG - Exonic
1020137232 7:5594150-5594172 CCTCCCCCCGCCGGCTGTCCTGG + Intronic
1020278320 7:6637550-6637572 CCTCCCCGCGCCGGGCGTCGAGG - Intronic
1023835871 7:44066784-44066806 CCTGCCAGCCTTGGGGGTCCTGG - Intronic
1023871152 7:44263629-44263651 CCTCCACGCCTCCGGTGTCCGGG - Intronic
1026942128 7:74293271-74293293 CCTGCCAGCTTCCGGGGTCCCGG - Intronic
1029736750 7:102469458-102469480 CCTCCCCGCCTCGGAGGGGCTGG + Intronic
1029927096 7:104329261-104329283 CCTCCCCGGCTCGGGCGCCCCGG - Intronic
1034425254 7:151010593-151010615 CCTCGTAGCGTCGGGGATCCTGG - Exonic
1035870323 8:3130565-3130587 CTTCCCCGGGTCAGGGGGCCTGG - Intronic
1036197529 8:6733355-6733377 CCTCCCCTCACCAGGGGTCCTGG + Intronic
1051033855 9:12718781-12718803 CTTCTCCGCGTCTGGGGTGCAGG + Intergenic
1052901012 9:33795112-33795134 CCTCCTCTCGTGGGGGCTCCAGG + Intronic
1053452349 9:38203572-38203594 CCTCCCCACATCTGGTGTCCAGG - Intergenic
1057542731 9:95990548-95990570 CCTGCCCGCGAAGGGGGTCAAGG - Intronic
1061399961 9:130362904-130362926 CCTCCCAGAGTCGGAGGCCCGGG - Intronic
1061485681 9:130919481-130919503 CCTCCCCGGCACAGGGGTCCAGG + Intronic
1062146449 9:134992280-134992302 CCTCCCCGCGGAGGGTCTCCAGG + Intergenic
1062467331 9:136687055-136687077 CCGCCCCGCTCCGGGGCTCCGGG - Intronic
1062551015 9:137086532-137086554 CATCCCCGCGCCGCGGGTTCCGG + Intergenic
1062558818 9:137130070-137130092 CATCCCCGCGCCGCGGGTCCCGG - Intergenic
1203466975 Un_GL000220v1:96606-96628 TCTCCCCGCCTCAGGGGTGCTGG + Intergenic
1187249084 X:17580930-17580952 CCTCCCCGCCCCAGTGGTCCTGG - Intronic
1190713897 X:53088279-53088301 CCTCCCCGCTTCGGGGGTCAGGG - Exonic
1192372467 X:70525948-70525970 CCTCGGCGCGGCGGGGGTCAGGG + Intergenic
1198184072 X:134237127-134237149 CCTGCGCGCGTCCGGAGTCCGGG + Exonic