ID: 970333889

View in Genome Browser
Species Human (GRCh38)
Location 4:15011629-15011651
Sequence CTCCTATTTTTTTGGGAAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 445
Summary {0: 1, 1: 1, 2: 3, 3: 23, 4: 417}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
970333889_970333893 -3 Left 970333889 4:15011629-15011651 CCCTCTTCCCAAAAAAATAGGAG 0: 1
1: 1
2: 3
3: 23
4: 417
Right 970333893 4:15011649-15011671 GAGTTTTCAGTTTAATGTTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
970333889 Original CRISPR CTCCTATTTTTTTGGGAAGA GGG (reversed) Intronic
900209452 1:1446714-1446736 CTCCTATTTTTTGGTACAGACGG + Intergenic
900219271 1:1498576-1498598 CTCCTATTTTTTGGTACAGACGG + Intergenic
902133334 1:14282627-14282649 CTCCTGTTTCCTTGGTAAGAGGG - Intergenic
904396002 1:30222717-30222739 CTGCTATTTAGATGGGAAGATGG + Intergenic
904935133 1:34124814-34124836 CTCACATTTTTTTGTAAAGATGG + Intronic
907918277 1:58890497-58890519 CTTATATTCTTATGGGAAGACGG + Intergenic
908273857 1:62448886-62448908 CTCCTTTTTTTTTTGAAACAGGG + Intronic
909105708 1:71404678-71404700 CCCCTATTTTTTTTTAAAGAAGG - Exonic
910497634 1:87850288-87850310 CTTCTATTTCTTTGGCAAGGAGG + Intergenic
910790690 1:91046815-91046837 ATCCTGTTTTTGTGGGGAGAGGG + Intergenic
911048647 1:93650734-93650756 CACCGAATTTTTTGGGGAGAGGG - Intronic
911210470 1:95133593-95133615 CTTCTACTTTTTTGTGAAGTAGG + Intronic
912770530 1:112460285-112460307 GGCATATTTTGTTGGGAAGAGGG + Exonic
912784142 1:112583303-112583325 CTGCTATTTTTATGGCCAGAGGG - Intronic
912873134 1:113328118-113328140 CTCTTCTTTTCTTGGGAAGAAGG + Intergenic
912968479 1:114258204-114258226 CTCTCATTTTTTTGGGAAGAGGG + Intergenic
914970131 1:152301804-152301826 CTCCTAGTGTCTTTGGAAGAAGG + Intergenic
916233593 1:162563180-162563202 CTACTATTTTTGTGGCATGAAGG + Intronic
917059989 1:171027087-171027109 TTCCATTTTTTTTTGGAAGAAGG - Intronic
917181357 1:172301557-172301579 CTACTATTATTTTCTGAAGATGG - Intronic
917561329 1:176160076-176160098 TTCCTATTATTTTCTGAAGAGGG - Intronic
917745495 1:178002888-178002910 CTCCTAGATGTTTGAGAAGAGGG - Intergenic
917953357 1:180064483-180064505 CTCCTAACTTTTCAGGAAGATGG - Intronic
919028041 1:192202564-192202586 CTCCTGCTGCTTTGGGAAGAAGG - Intergenic
919455182 1:197812758-197812780 CTGCTAGTGTTTTGGGAAAAAGG - Intergenic
919943199 1:202302465-202302487 CTCCTATTTTATTGAGGACACGG - Intronic
920770543 1:208880888-208880910 AACCTATTTTTTTGAGAACAAGG + Intergenic
921082335 1:211752021-211752043 CTACAATTGTATTGGGAAGATGG - Intronic
922367919 1:224883305-224883327 CTCCTATATTTTTGGAAAACTGG + Intergenic
923811857 1:237326909-237326931 CTGCTTTATTTTTGGGAAGTGGG + Intronic
924409065 1:243784421-243784443 TTCCTTTTTTTTTTTGAAGAGGG - Intronic
1064362551 10:14679134-14679156 TTCCTTTTTTTTTGGAGAGAGGG + Intronic
1064923472 10:20543805-20543827 CACCTATTTTTTTGAGATGATGG - Intergenic
1064976996 10:21127118-21127140 TCTCTACTTTTTTGGGAAGAGGG - Intronic
1065182308 10:23138887-23138909 TTCCTATTTTTTCTGGGAGAGGG + Intergenic
1066179498 10:32946181-32946203 CTCTTTTATTTTTGGGAGGAGGG - Intronic
1066237629 10:33501849-33501871 CTCCTTTTTTTTTTTAAAGATGG - Intergenic
1066750595 10:38652502-38652524 TTCTTATTTTCTTGTGAAGATGG - Intergenic
1066966453 10:42270611-42270633 TTCCTATTTTCTTGTGAAGATGG + Intergenic
1067019256 10:42781066-42781088 CTCCTATCTGCTTGGTAAGATGG - Intergenic
1067526770 10:47043949-47043971 CACACATTTTTTTGGGAAGAGGG - Intergenic
1069421966 10:68254578-68254600 TTCTCATATTTTTGGGAAGATGG - Intergenic
1069481183 10:68783760-68783782 CTGCTTTTTTTTTTTGAAGATGG + Intronic
1069934441 10:71905644-71905666 CTCCTCTTTTGTCGGGAGGATGG + Intergenic
1070473834 10:76812774-76812796 CTCATATTATTTAGGGCAGATGG - Intergenic
1070807645 10:79279788-79279810 TTCCTATTTTTTGGTGGAGACGG - Intronic
1071808948 10:89156906-89156928 CTCTTATTTTTCTGAGAAAAGGG - Intergenic
1072701309 10:97643285-97643307 GTCCTTTTTTTGTGGGCAGAGGG + Intronic
1072712958 10:97729769-97729791 CTTCTATTTTTTTTTTAAGACGG + Intergenic
1072987742 10:100156438-100156460 GTGCTAGTTTTGTGGGAAGAAGG + Intronic
1073011346 10:100362376-100362398 CTCATTTTTTTTTGAGGAGAAGG + Exonic
1073072651 10:100804477-100804499 CTCCTACCTTTTGGGGAAGCCGG - Intronic
1073301761 10:102475289-102475311 CTTTTTTTTTTTTGGAAAGAGGG - Intronic
1073387772 10:103141449-103141471 TTGTTATTTTTTTGGGAACAGGG - Intronic
1073645804 10:105302357-105302379 TGCATATTTTTGTGGGAAGATGG - Intergenic
1073679653 10:105688833-105688855 CTCCTATTTTTTCTGGGAGAGGG + Intergenic
1074447685 10:113533866-113533888 AACCCATTTTTGTGGGAAGAGGG + Intergenic
1074559988 10:114526972-114526994 CCCCTCCTTTTTTGGGAACATGG - Intronic
1075610141 10:123847091-123847113 CTACAATTTTATTGGAAAGATGG + Intronic
1076253160 10:128998861-128998883 CTCCGATTTTGATGGAAAGAAGG + Intergenic
1076516473 10:131047821-131047843 CACCCATTTATTAGGGAAGAGGG + Intergenic
1077699163 11:4424003-4424025 CTCCTGCTTTCTTGTGAAGAAGG + Intergenic
1078204208 11:9213800-9213822 CTTCTTTTTTTTTTGGGAGACGG - Intronic
1079903447 11:26217158-26217180 CTCCTATTTTATTGTCTAGAAGG + Intergenic
1079996792 11:27304175-27304197 CTTCTATTTTTTTGGGTGGGAGG + Intergenic
1080365803 11:31572828-31572850 TTCCTATTTTTTTGTAGAGATGG - Intronic
1080747694 11:35123454-35123476 CTCCTCCTTTTGTGGGGAGAAGG - Intergenic
1081174605 11:39912217-39912239 CTCCTTTTTTTCAGGGCAGAAGG + Intergenic
1081473529 11:43400687-43400709 ATTTTATTTTTCTGGGAAGAGGG + Intronic
1081543338 11:44051870-44051892 TTCCTATTTCTGTGGGAACAAGG + Intronic
1082851809 11:57771895-57771917 CTGATATGTTTTTGGGAAGTGGG + Intronic
1085068865 11:73523275-73523297 TTCATATGTTTTTGGGGAGAAGG + Intronic
1085951943 11:81342803-81342825 CTTTTTTTTTTTTAGGAAGAAGG + Intergenic
1090184752 11:124729890-124729912 CACCTATCTTTTTGACAAGATGG - Intergenic
1090342488 11:126037103-126037125 TTCTTTTTTTTTTTGGAAGATGG + Intronic
1091714079 12:2764641-2764663 CTCCAATTTCTCTGGGAAAATGG - Intergenic
1091721122 12:2814657-2814679 TTTCTATTTTTTTGTAAAGACGG - Intronic
1093717105 12:22395402-22395424 CTACTGTTTATTAGGGAAGAAGG - Intronic
1093929926 12:24945660-24945682 TTCGTATTTTTTTGTAAAGACGG - Intronic
1095309759 12:40684629-40684651 TTCCTATTTTTTGGAGGAGAGGG + Intergenic
1096129477 12:49146272-49146294 CTTCTATTTTTTTGGAAACACGG - Intergenic
1097016288 12:55989644-55989666 CTCCTATTTTGGTTAGAAGAAGG + Intronic
1097072222 12:56363380-56363402 CTCCTTTTTTTTTTTTAAGACGG - Intergenic
1097111571 12:56662572-56662594 CAGCTATTTTTTTGTCAAGATGG + Intergenic
1098974085 12:76884036-76884058 CTCATATTTTTGTTGGCAGAAGG - Intergenic
1099099727 12:78423641-78423663 CTTCCATTTTTATAGGAAGATGG + Intergenic
1099630288 12:85133784-85133806 CTCACAGCTTTTTGGGAAGAAGG + Intronic
1099869220 12:88325472-88325494 GTCCTATTTTTCAGGGAAGCTGG - Intergenic
1100498540 12:95150615-95150637 GTCCTTTTTTTTTTGGAAAAAGG + Intronic
1100646576 12:96538084-96538106 CTCCTTTTTTTTTTGAAACAGGG - Intronic
1101024939 12:100592461-100592483 ATCCTGTATTTTTGGGACGAAGG + Intronic
1102914130 12:116740177-116740199 CTCCTTTTTTTTTTTTAAGACGG - Intronic
1103182212 12:118923260-118923282 CTGCTATTTTCTGGGGAACAAGG + Intergenic
1104153356 12:126106569-126106591 CCCCCACTTTTTTGGGTAGACGG - Intergenic
1105207981 13:18239000-18239022 TTCCTGTCTTTTGGGGAAGATGG - Intergenic
1106801233 13:33258299-33258321 CATCTATTTTTTTAGGAAAATGG - Intronic
1107233817 13:38144625-38144647 CCCCTATTTTATTGAGAAAAAGG + Intergenic
1107430566 13:40336602-40336624 CTTGTATTTTTCTGGGAGGAGGG - Intergenic
1107537345 13:41348675-41348697 CTCCTCTTTTTTTGGGGGGGCGG + Intronic
1108025016 13:46168647-46168669 CTCCTAGTTTCTAGGCAAGACGG + Intronic
1108286846 13:48917201-48917223 CTGCTATTTTATTTTGAAGATGG + Intergenic
1108875178 13:55038614-55038636 CTTCTATTTCTTTAGTAAGAAGG + Intergenic
1109226161 13:59698680-59698702 TTCCTATTTTTTAAGGAAGCAGG - Intronic
1109741121 13:66556954-66556976 CTCCTTTATCTTTGTGAAGAAGG - Intronic
1110779228 13:79445586-79445608 GTCCTTTCATTTTGGGAAGAAGG + Intergenic
1111178370 13:84628760-84628782 CTCATTTTTTTCAGGGAAGATGG + Intergenic
1112092303 13:96094370-96094392 CTCATGGTTTTTTAGGAAGAAGG - Intronic
1112332310 13:98485962-98485984 CTCCCATTTCTGTGGGAAGGAGG - Intronic
1112348148 13:98609924-98609946 TTCCTGTTTTTGTGGGGAGAAGG - Intergenic
1114959732 14:27870811-27870833 CTACTATTTTTTTAGGGAGGGGG - Intergenic
1114968801 14:28000470-28000492 CTCCTTTTTTGTTGGGGAGATGG + Intergenic
1115660770 14:35492324-35492346 TTACTATTTTTTTGGGGGGAGGG - Intergenic
1116069405 14:40025099-40025121 CTCCAATTTTTTTTGGAGGGGGG - Intergenic
1117580614 14:57147991-57148013 CTACTTTTCTTTTGGGATGATGG - Intergenic
1117621906 14:57595866-57595888 CTTCTATTTCTTTGGAATGATGG + Intronic
1117657696 14:57973434-57973456 CTATTATAATTTTGGGAAGAAGG - Intronic
1118142588 14:63100783-63100805 CTCTTATCTTTGTGGGCAGAAGG - Intronic
1119359939 14:74040929-74040951 CTCCCATTATATAGGGAAGATGG + Intronic
1120194323 14:81465966-81465988 CTCCTGCTTTCTTGGGAACAGGG + Intergenic
1121086735 14:91152218-91152240 CTGTTATTTTTTTGTAAAGATGG - Intronic
1122331323 14:100916970-100916992 CTCCTATTCTTTTTGTAAGTGGG - Intergenic
1124414475 15:29463606-29463628 CTCATATTTTGTTGGGTAGCAGG - Intronic
1125848243 15:42878788-42878810 AGGCTATTTTGTTGGGAAGAAGG + Intronic
1125867810 15:43069812-43069834 CTCGTTTTTTTATGGGCAGATGG + Intronic
1126232637 15:46344743-46344765 CTCCTGTTGCTTTGGGAAAAGGG + Intergenic
1126572308 15:50165052-50165074 TTTCTTTTTTTTTGGGGAGATGG + Intronic
1126612260 15:50541504-50541526 TTCCTTTTTTTTTGGAAACATGG - Intronic
1128033018 15:64498553-64498575 GTCCTATTTTAGTGGGAAGTGGG + Intronic
1128057817 15:64713655-64713677 CTCTTTTTTTTTTGGGGGGATGG - Intergenic
1128671331 15:69576616-69576638 CTCTTGTTTTTTTGGGGAAAGGG + Intergenic
1129569946 15:76671167-76671189 CTGCTAATATTTTGTGAAGATGG - Intronic
1130622642 15:85479579-85479601 CTCCTATTTTTTTGTGGATTTGG + Intronic
1130645892 15:85726648-85726670 ATAATAATTTTTTGGGAAGAGGG - Intronic
1131170529 15:90174969-90174991 GTCCTATTTTTTTTGGAGGGGGG + Intronic
1133183199 16:4075003-4075025 TTTCTATTTTTTTGTGGAGACGG - Intronic
1133307280 16:4818451-4818473 CACCTAATTTTTTGTGGAGATGG + Intronic
1133670445 16:8013746-8013768 CTCCTACATTTTGGAGAAGAGGG - Intergenic
1136411040 16:30077362-30077384 ATTCTATTTCTTTTGGAAGAGGG + Intronic
1136511377 16:30739858-30739880 CCCCTACTTTGGTGGGAAGAAGG - Exonic
1136732129 16:32424587-32424609 TTCTTATTTTCTTGTGAAGATGG + Intergenic
1138380304 16:56596331-56596353 TTTCTAATTTTTTGGAAAGACGG - Intergenic
1140277284 16:73521976-73521998 TTGCTATTTTTTTGGCAAAAGGG - Intergenic
1140398893 16:74653483-74653505 CTTCTTTTTTTTTTTGAAGATGG - Intronic
1140637193 16:76929059-76929081 CTCCTGTTTTTTTGAGGAGTTGG + Intergenic
1141695845 16:85619038-85619060 CTCCAGTCTTTTTGGGAAAAGGG - Intronic
1142067082 16:88068831-88068853 CTCTTCCTTTCTTGGGAAGAAGG + Intronic
1202994265 16_KI270728v1_random:92657-92679 TTCTTATTTTCTTGTGAAGATGG - Intergenic
1203020952 16_KI270728v1_random:404999-405021 TTCTTATTTTCTTGTGAAGATGG - Intergenic
1203039287 16_KI270728v1_random:678157-678179 TTCTTATTTTCTTGTGAAGATGG - Intergenic
1143041046 17:4036725-4036747 CTCTTTTTTTTTTTTGAAGATGG - Intronic
1143591947 17:7890422-7890444 CTCCTTTTTTTTTTTGGAGATGG - Intronic
1145051072 17:19661281-19661303 CTCCTTTTCCTATGGGAAGATGG + Intronic
1148033462 17:44639344-44639366 CTCCAATTTCTTTGGTAGGAAGG - Intergenic
1150888210 17:69112206-69112228 CTTCTATGTTTTTGAAAAGAAGG - Exonic
1150942666 17:69710025-69710047 CTGTAATTTTTATGGGAAGAGGG + Intergenic
1151094790 17:71484426-71484448 ATCATATTTTTTAGGGACGAAGG - Intergenic
1151601197 17:75107294-75107316 CTTTTTTTTTTTTGGGAAGGGGG - Intergenic
1152221572 17:79071330-79071352 TTCATATTTTTTTGGAGAGATGG + Intergenic
1153205880 18:2700216-2700238 CTCCTATATTTGTAGGAAGGAGG + Intronic
1153276160 18:3369754-3369776 TTTTTATTTTTTTGGAAAGATGG - Intergenic
1153437075 18:5079028-5079050 GTCCTATTTATTTGGGACAAGGG - Intergenic
1153495197 18:5691150-5691172 CTTTTATTTTTTTGGGGGGATGG + Intergenic
1153673775 18:7437444-7437466 TTCTTATTTTTTTGTAAAGATGG + Intergenic
1154045664 18:10902559-10902581 CTCATACGTTTTTGGGAGGAGGG - Intronic
1155421695 18:25663263-25663285 GTTTTATTTTTTTGTGAAGATGG - Intergenic
1157579023 18:48762812-48762834 CTCCCAGCTTTTAGGGAAGACGG - Intronic
1158221404 18:55154546-55154568 CTCATATTGTGATGGGAAGAAGG - Intergenic
1158260119 18:55597393-55597415 CTCCTTTTCTTTGGGGGAGAGGG - Intronic
1158500775 18:57998961-57998983 ATCTTATTTTTTTTGAAAGAGGG - Intergenic
1159055859 18:63463347-63463369 CACCTACTTCTTTGGGGAGATGG - Intergenic
1160347943 18:78150409-78150431 CTCCTGTTGCTTTGTGAAGAAGG + Intergenic
1160498480 18:79389109-79389131 CTCCTATTTTGTTGGAAACTGGG - Intergenic
1161032517 19:2064756-2064778 CTCCTACTTTGTGGGAAAGAGGG - Intergenic
1161352306 19:3800640-3800662 TTCCTTTTTTTTTCTGAAGACGG - Intronic
1162254179 19:9474662-9474684 AGCCTTTTTTTTTGGGAAGCAGG + Intronic
1162269906 19:9605701-9605723 CTCTTATTTTTTTGTAGAGATGG + Intronic
1163345285 19:16737425-16737447 CTAGTATTTTTTTGGAAATATGG + Intronic
1163735774 19:18979601-18979623 CTCTTTTTTTTTTGAGACGAAGG - Intergenic
1164997837 19:32735963-32735985 CTCCTATTTATTTTTTAAGATGG - Intronic
1165088198 19:33366079-33366101 CCCCAATCTTTTTGGCAAGAGGG - Intergenic
1166031928 19:40137838-40137860 AGTCTATTTTTTTGGGAAGTTGG - Intergenic
1166193251 19:41189974-41189996 CTCCTATTTTTTTTTTGAGACGG + Intergenic
1166619666 19:44284838-44284860 ATCCTATTTTTATGGAAAGTGGG - Intronic
1166963857 19:46515910-46515932 CTTTTTTTTTTTTGGTAAGACGG - Intronic
1167666902 19:50827587-50827609 CTCCTAGATTTGGGGGAAGACGG - Intronic
1167838591 19:52095564-52095586 CTCCTACTTACTTGGGACGAAGG + Intronic
925106137 2:1294144-1294166 CTCCTATTTTTTGGAGGAGATGG + Intronic
926570264 2:14521905-14521927 CTGCTATTGTTTTTGGAATATGG + Intergenic
927579161 2:24225820-24225842 ATCCTCTTTTTTTGAGAGGAGGG + Intronic
927646467 2:24880178-24880200 GTCCTCTTTGTTTTGGAAGAGGG - Intronic
927756907 2:25715985-25716007 CTCCTCTTTTTTTGGGGTGGGGG - Intergenic
929040007 2:37735468-37735490 CTTTTTTTTTTTAGGGAAGATGG - Intronic
930601265 2:53445737-53445759 TTCCTTTTTTTCTGGGCAGATGG - Intergenic
931036428 2:58249040-58249062 CTTGTATTTTTTTGTGGAGATGG + Intergenic
931591613 2:63889553-63889575 TTCCTATTTTGCTGGGAAAATGG - Intronic
932248801 2:70221461-70221483 CTCTTTTTTTTTTGGAGAGAGGG - Intronic
933228392 2:79777658-79777680 ATCCTTTTGTTTTGGTAAGATGG - Intronic
934313596 2:91894657-91894679 TTCTTATTTTCTTGTGAAGATGG - Intergenic
935487410 2:103674789-103674811 ATCCCATTTTCTTGAGAAGATGG + Intergenic
935889424 2:107659704-107659726 CTCCTATTTTATTGGGATTGAGG - Intergenic
936092014 2:109507553-109507575 CTCCTATCACTGTGGGAAGATGG - Intergenic
936375922 2:111941584-111941606 CTCCTGTTTTTCTGGGCAGAGGG + Intronic
936506148 2:113108897-113108919 ATCATATTTTTTTGGGTAGGGGG + Intronic
937095454 2:119232504-119232526 CTCCTCTCTGTTGGGGAAGACGG + Intronic
937386684 2:121440527-121440549 CTGCTAATTTTTTGTGGAGATGG - Intronic
937606437 2:123806987-123807009 CTGCCATTTTTTTTGGAATATGG - Intergenic
937843910 2:126556175-126556197 TTCCTATTTTTTCTGGGAGAGGG - Intergenic
937962375 2:127470009-127470031 CTTCTATCTTCTTGGGAAGCTGG + Intronic
938654790 2:133420074-133420096 CTAATATCTTTTAGGGAAGATGG + Intronic
939283729 2:140101161-140101183 CTCATATTTTTATAGGGAGAGGG + Intergenic
939518152 2:143195209-143195231 CTCTTTTTTTTTTGGGAGGGGGG - Intronic
940877333 2:158911107-158911129 CTTTTTTTTTTTTGGGAAGTGGG + Intergenic
941323902 2:164088975-164088997 CTCCTGTCATTTTGTGAAGAAGG + Intergenic
941331330 2:164181059-164181081 CACGCATTTCTTTGGGAAGAGGG + Intergenic
941471610 2:165895314-165895336 AGCCAATTTTTTTGGGAAAAAGG + Intronic
941698226 2:168576082-168576104 CTCCTATTTCACTGGGATGATGG - Intronic
942389667 2:175478988-175479010 CCCAGATTTTTTTGGGAAAAAGG + Intergenic
942934547 2:181539406-181539428 CTCCAACTTTTTTTGGAAGAAGG + Intronic
943731546 2:191307966-191307988 ATTCTGTTTTTTTGGGGAGATGG - Intronic
944007355 2:194926179-194926201 CTCCCATTTTTTTATGTAGAAGG + Intergenic
944384114 2:199145170-199145192 CTCCTGTTTATTTGGGCACATGG + Intergenic
944431397 2:199637583-199637605 CTCCAATTTTTTTAAGAAAATGG + Intergenic
1169544507 20:6636904-6636926 CACATATTTTTCTGGGAAGAAGG + Intergenic
1170858497 20:20080089-20080111 TTACTAATTTTTTGGGGAGATGG + Intronic
1171526356 20:25814710-25814732 CTGATATTCTTTTGGGAAGCTGG + Intronic
1171550471 20:26041175-26041197 CTGATATTCTTTTGGGAAGCTGG - Intergenic
1171572594 20:26268106-26268128 CTGATATTCTTTTGGGAAGCTGG - Intergenic
1173612920 20:44383852-44383874 CTCCCATTTTTTTTTTAAGACGG + Intronic
1174690363 20:52498147-52498169 CTTCTATTTTTTTGTAGAGATGG - Intergenic
1176524216 21:7853135-7853157 CTCCTATCTTTGTGGGAACCTGG + Intergenic
1178658236 21:34483148-34483170 CTCCTATCTTTGTGGGAACCTGG + Intergenic
1178675101 21:34623999-34624021 CTCCTCTTTTACTGAGAAGATGG - Intergenic
1178943082 21:36923704-36923726 GTTTTATTTTTGTGGGAAGAAGG - Intronic
1179595109 21:42438132-42438154 CTCCTCTTTGTCTGGGAAGAGGG + Intronic
1179670543 21:42943938-42943960 CGCCTGTTTTTTTGGGCAGTAGG + Intergenic
1179997108 21:44979059-44979081 TTTCTATTTTTTTGTCAAGATGG - Intergenic
1180540337 22:16440560-16440582 TTCTTATTTTGTTGTGAAGATGG - Intergenic
1180574663 22:16761375-16761397 CTGATATTCTTTTGGGAAGCTGG + Intergenic
1180726261 22:17948735-17948757 TTTGTATTTTTTTGTGAAGACGG - Intronic
1180758546 22:18180885-18180907 TTCCTGTCTTTTGGGGAAGATGG - Intergenic
1180768833 22:18364677-18364699 TTCCTGTCTTTTGGGGAAGATGG - Intergenic
1180777479 22:18497718-18497740 TTCCTGTCTTTTGGGGAAGATGG + Intergenic
1180810199 22:18755028-18755050 TTCCTGTCTTTTGGGGAAGATGG + Intergenic
1180826708 22:18867901-18867923 TTCCTGTCTTTTGGGGAAGATGG - Intergenic
1181196343 22:21189280-21189302 TTCCTGTCTTTTGGGGAAGATGG + Intergenic
1181213184 22:21303844-21303866 TTCCTGTCTTTTGGGGAAGATGG - Intergenic
1181523834 22:23466831-23466853 TTCCTGTCTTTTGGGGAAGATGG - Intergenic
1182167105 22:28186895-28186917 CTGCTACTTTCTTGGAAAGAAGG - Intronic
1182633671 22:31707383-31707405 AACCTATTTTTTTTGGGAGACGG + Intronic
1183656950 22:39191655-39191677 TTTCTAGTTCTTTGGGAAGAAGG - Intergenic
1183812367 22:40267861-40267883 CTCTTTTTTTTTTGGCAACAGGG - Intronic
1184163802 22:42715549-42715571 CTGCTAATTTTTTGCAAAGAAGG - Intronic
1203230455 22_KI270731v1_random:105561-105583 TTCCTGTCTTTTGGGGAAGATGG - Intergenic
1203276851 22_KI270734v1_random:93811-93833 TTCCTGTCTTTTGGGGAAGATGG - Intergenic
949187185 3:1206276-1206298 CTCTTATTTCCTTGGGAAGTAGG - Intronic
949283897 3:2378733-2378755 CTCCTTTTTTTTTTTGAAGAAGG + Intronic
950296234 3:11834070-11834092 TTTGTATTTTTTTGTGAAGATGG - Intronic
951179553 3:19643392-19643414 CTCCTAAATTTTTGGAAAGTTGG - Intergenic
951547483 3:23842415-23842437 TTTCTATTTTTTTGTGGAGACGG + Intronic
951876234 3:27429260-27429282 CTCTTTTTTTTTTGTGGAGATGG - Intronic
951958592 3:28287440-28287462 CTCCTACTGTTTTGGTAAGAGGG + Intronic
951961691 3:28331861-28331883 CTTCTATTCTTATGCGAAGAGGG + Intronic
952736459 3:36696172-36696194 CTCCTTTTTTTGTGGAAGGAAGG + Intergenic
953291464 3:41668081-41668103 CTCCAATTTTGTTGAGAGGAGGG + Intronic
954253774 3:49389308-49389330 CTCCTTTTTTTTTTTGGAGATGG - Intronic
955194838 3:56795653-56795675 CTCTTTTTTTTTTTTGAAGATGG + Intronic
955833800 3:63031690-63031712 TTTGTATTTTTTTGGAAAGATGG - Intergenic
956029877 3:65025995-65026017 CTCGCAGTTTGTTGGGAAGATGG + Intergenic
956973412 3:74552830-74552852 CTCCTGCTGTTTTGTGAAGAAGG + Intergenic
957365571 3:79218506-79218528 ATCCTATTTTATTGCAAAGAGGG + Intronic
960014368 3:112870230-112870252 CTCCTATTATTTTGTTAAGTGGG + Intergenic
960674193 3:120179258-120179280 CTCCTATCTCTATGGGAAGCTGG + Intronic
960813353 3:121647501-121647523 CTTCCATTTTTCTGGGAAGATGG - Intronic
961224376 3:125226954-125226976 CTCCTATTTTTTGGGGGAGAGGG + Exonic
961258505 3:125579808-125579830 TTCCTCTTTTTTTGAGAAGTTGG - Intronic
961533135 3:127552130-127552152 CTGATATTTCTCTGGGAAGATGG - Intergenic
963930264 3:150996738-150996760 CTCCAGTTTTTCTGGGATGAGGG + Intergenic
964498134 3:157317456-157317478 CTCCCATTTTATTGGTGAGAGGG - Intronic
965815791 3:172635360-172635382 CCCCAATTTTTTTGGCAAGTGGG - Intronic
965837708 3:172869538-172869560 CTCCTATTTCACTGGGAAAATGG + Intergenic
966194492 3:177299578-177299600 CTTCTATTATTTTGAGAGGATGG - Intergenic
966271112 3:178106963-178106985 CTCCTATGTTTTTGGAAGCATGG - Intergenic
966339458 3:178909176-178909198 TTCGTATTTTTTAGTGAAGACGG - Intergenic
966386803 3:179407894-179407916 CTCGTAATTTCTTGAGAAGAGGG + Intronic
966894889 3:184437125-184437147 CTTCTTTTTTTTTTTGAAGACGG + Intronic
967862774 3:194164844-194164866 ATCATATTATTTTGGGATGAAGG - Intergenic
968795496 4:2701075-2701097 CTCTTATTTTTCTGGACAGAAGG + Intronic
968823814 4:2877958-2877980 CTCCTTTTTTTTTGGAGACAGGG - Intronic
970333889 4:15011629-15011651 CTCCTATTTTTTTGGGAAGAGGG - Intronic
970906399 4:21221459-21221481 CTCCTACTGCTTTGTGAAGAAGG - Intronic
971386358 4:26143754-26143776 TTCCTATTTTTTTGTAGAGACGG - Intergenic
971455823 4:26842670-26842692 CTCTTATTTTTTTGTAAAGATGG + Intergenic
971685755 4:29764818-29764840 CTCCTTTTTTATTGGTAAGTTGG - Intergenic
971886072 4:32449842-32449864 ATCTTATTTTCCTGGGAAGATGG + Intergenic
971916526 4:32876672-32876694 CTCCTATTTTCTCTGGAGGATGG + Intergenic
971972103 4:33634001-33634023 CTCCTACTGCTTTGTGAAGAAGG + Intergenic
972126496 4:35773228-35773250 TTACTGTTTTATTGGGAAGAAGG - Intergenic
973021924 4:45214162-45214184 CTCCTTTTTTTTTGAGATGGGGG + Intergenic
973636154 4:52863102-52863124 CTCCTTTTTGTCTGGAAAGAAGG + Intronic
975242807 4:72081658-72081680 TTTCTATTTTTTTGTGGAGATGG + Intronic
975372534 4:73605262-73605284 CTTGTATGTTTTTGGAAAGATGG + Intronic
975419523 4:74146518-74146540 CTCCCAGGTTCTTGGGAAGAGGG - Intronic
976155076 4:82135392-82135414 CTCCTGTTTCTTTGACAAGATGG - Intergenic
976403500 4:84635759-84635781 TTCCTTTTTTTTTTTGAAGATGG + Intronic
978044678 4:104112000-104112022 TTCATATTTTTTTGTGGAGACGG + Intergenic
978912382 4:114079457-114079479 CTCCTGCTGTTTTGTGAAGAAGG - Intergenic
978996933 4:115168716-115168738 TTCCTGTTTTTTTGGTATGATGG + Intergenic
979803775 4:124945172-124945194 CTCCTATTTTTTTATGCAGTAGG - Intergenic
980641558 4:135586354-135586376 TTCCTTTTTTCTTGTGAAGAAGG + Intergenic
980953025 4:139400362-139400384 CTCCAAATTTTTTGTGAAGTAGG + Intronic
981601397 4:146492540-146492562 TTTGTATTTTTTTGGAAAGATGG + Intronic
982290162 4:153772896-153772918 CTCTTATTTTTTAAGGTAGAAGG + Intergenic
983226644 4:165091657-165091679 CTCCTAAATTTTGGGGAAAATGG + Intronic
983641571 4:169948241-169948263 CTCCTACTTTATGGGGAAGATGG - Intergenic
983658418 4:170106997-170107019 CTCCAATTCTTTGGGGAAAATGG - Intergenic
983908597 4:173210458-173210480 TTCCTTTTTTTTTGGAAACAGGG + Intronic
986454707 5:7904695-7904717 CTCCTTTTTTGTTGGGGAGGAGG + Intronic
986914139 5:12595817-12595839 TTTCTATTTTTTTGTAAAGATGG + Intergenic
987438011 5:17921715-17921737 CTTCTTGTTTATTGGGAAGAAGG + Intergenic
987546631 5:19318859-19318881 CTACTATTTTCTTGGGGAGATGG - Intergenic
988290969 5:29286216-29286238 TTCCTTTTTTTTTGGAAAGTGGG + Intergenic
988685186 5:33518913-33518935 CTCTTCTTTTTTTGGGAGGTGGG - Intergenic
989643957 5:43608912-43608934 CTCCAATTTTAGTGGGAAAATGG + Intronic
989653179 5:43716179-43716201 CTCTTTTTTTTTTTGGGAGACGG + Intergenic
989985326 5:50690275-50690297 CTCCATTTCTTTTTGGAAGAAGG + Intronic
990428965 5:55716180-55716202 CTCCTCTTTTTTAAGGAAAAAGG + Intronic
991116099 5:62957350-62957372 CTCTTATTTTTCTGGGGGGACGG + Intergenic
992753913 5:79886490-79886512 CACAAATTTATTTGGGAAGAAGG + Intergenic
992989363 5:82268479-82268501 CTCCTGTTTTTATGGGCAGTAGG + Intronic
993118466 5:83745859-83745881 CTCTTCTATTTTTTGGAAGAGGG + Intergenic
994079470 5:95690741-95690763 CTCCTATATTTCTGGGAAACTGG - Intronic
994684895 5:102937512-102937534 CTCCTTTTCTTTTCAGAAGAAGG - Intronic
994750526 5:103732126-103732148 AACCTATATTTTTGGGAAAAAGG - Intergenic
995242566 5:109901550-109901572 GTCCTATTTGTTTGGGAAAAAGG + Intergenic
995470961 5:112501498-112501520 CTCCTATTTTTTTGGGGAGAGGG + Intergenic
996035542 5:118754473-118754495 CTTTTATTTTTTTGTGGAGAGGG - Intergenic
996671693 5:126124904-126124926 TGCCTATTTTTTTTGGCAGAGGG - Intergenic
996946206 5:129072095-129072117 CTCCTATTTTGTTTGGAAAGTGG + Intergenic
997178388 5:131802379-131802401 CTCCTCTTTTTTTGCTGAGATGG + Intergenic
998131958 5:139655803-139655825 TTTCTGTTTGTTTGGGAAGAGGG + Intronic
999167067 5:149558505-149558527 TTCTTATTTTTTTGGTGAGAGGG - Intronic
999850920 5:155537682-155537704 CTTAAATTTTTTTGGGGAGATGG + Intergenic
1000811168 5:165863670-165863692 CTCCTTTTTTTTTGGGGGGGTGG + Intergenic
1003463264 6:6352141-6352163 TTTTTATTTTTTTGGGGAGATGG + Intergenic
1003508352 6:6758819-6758841 TTTCTTTTTTTTTGGAAAGAAGG - Intergenic
1004368606 6:15033162-15033184 TTCCTAATTTTTTGTAAAGATGG + Intergenic
1005361657 6:25036802-25036824 CTCCTGTTCTTCTGGGAAAATGG - Intronic
1005511290 6:26513820-26513842 CTGCTATTGATTAGGGAAGAGGG - Intergenic
1005699833 6:28389318-28389340 ATCCTAGTTTTTTGGCATGATGG + Intronic
1005889181 6:30122505-30122527 CTCCAAATTATTTGGGGAGATGG + Intergenic
1006862020 6:37178221-37178243 CTTCTATTTTTTTGTAGAGATGG - Intergenic
1007861390 6:44912969-44912991 CACACATTTTCTTGGGAAGAAGG - Intronic
1007932114 6:45700711-45700733 CTCCTATTTCATTGGGAATCTGG + Intergenic
1008170979 6:48204993-48205015 CACTTACTTTTTTGAGAAGAAGG + Intergenic
1009554895 6:65149948-65149970 CTCCTGCTGCTTTGGGAAGAAGG - Intronic
1012025535 6:93985626-93985648 TTCCTTTTTTTTTGTGGAGAAGG - Intergenic
1012189533 6:96262174-96262196 CTCCTTTGCTTTTGGAAAGAGGG + Intergenic
1012530212 6:100226505-100226527 CTCCTTTCTTTTTGAGGAGAAGG - Intergenic
1013080680 6:106809245-106809267 TTCCTTTTTTTTTGGTAACATGG + Intergenic
1014381154 6:120743920-120743942 CTTCTATCTTTTTTGGATGAGGG + Intergenic
1014720087 6:124906054-124906076 CTCCCATTCTTTTAGGATGAAGG + Intergenic
1014988069 6:128036737-128036759 CTCCTTTTTTTTTTTTAAGATGG + Intronic
1015190245 6:130464303-130464325 CTCCTATTTTCTTAGTAATATGG + Intergenic
1015393751 6:132712646-132712668 CTCCTCTTTTTCTGAGAAGCAGG - Intronic
1015490790 6:133823376-133823398 TTGCTTTTTTTTTGGTAAGATGG - Intergenic
1017820801 6:158047954-158047976 CTCCTGTCTTTGTGGGAACAGGG + Intronic
1018221449 6:161584271-161584293 GTCCTATTTGATTGGGAAGCTGG - Intronic
1018595313 6:165473550-165473572 CCTCTATATTTTTGAGAAGACGG - Intronic
1020424463 7:8048407-8048429 CACCAATTTTTTTGGGGAGGTGG + Intronic
1020590501 7:10130707-10130729 ATCCTGTATTTATGGGAAGAAGG + Intergenic
1020739425 7:11994872-11994894 CTCCTATTATTTTGATATGATGG - Intergenic
1020762528 7:12286190-12286212 CTTGTATTTTTTTGTGGAGATGG + Intergenic
1021469327 7:20983454-20983476 CGGCTAATTTTTTGTGAAGACGG + Intergenic
1023902398 7:44492230-44492252 CTTCTTTTTTTTTGTGGAGACGG - Intergenic
1023917116 7:44597722-44597744 TTTGTATTTTTTTGGAAAGATGG + Intergenic
1024029196 7:45442676-45442698 CTCCTGTTTTTTTGGAAAGCTGG + Intergenic
1025828853 7:65033131-65033153 TTCGTATTTTTTTGTGGAGACGG + Intergenic
1026363477 7:69624771-69624793 CTGGTATACTTTTGGGAAGATGG - Intronic
1026992988 7:74598214-74598236 CTCTTTTTTTTTTGGAAACAGGG - Intronic
1027177980 7:75916475-75916497 CTTCCTTTTTTTTGGGAGGAGGG + Intronic
1028331225 7:89594560-89594582 TTCCCATTCTTTTGGGAAGTAGG + Intergenic
1028548487 7:92029609-92029631 CGACTGTTTTTTTGGAAAGATGG - Intronic
1030821785 7:114101656-114101678 CTCTTATTTTTTTAGGTAAAAGG - Intronic
1030868526 7:114729020-114729042 TTTGTATTTTTTTGGAAAGATGG + Intergenic
1031160407 7:118160764-118160786 ATCTTGTTTTTTTGGGAAAAAGG - Intergenic
1032257633 7:130309935-130309957 TTTGTATTTTTTTGTGAAGATGG + Intronic
1032869954 7:135974532-135974554 CTCCTCTTTTTTTTGGAAACAGG - Intronic
1033826529 7:145197383-145197405 ATTCTATTTTTTTGAGAAGGTGG + Intergenic
1034278676 7:149836703-149836725 CTCCATTTTTCTTGGAAAGATGG + Intergenic
1036724125 8:11203970-11203992 CTTCTACTTTCTTTGGAAGAAGG + Intergenic
1036956655 8:13194836-13194858 TTCCTATATTTTTGTAAAGATGG - Intronic
1038897705 8:31804488-31804510 CCCCTCTTTTTATGGGAAGTAGG + Intronic
1039321188 8:36433724-36433746 CTTTTATTTTTTTGTAAAGATGG + Intergenic
1041058276 8:54010291-54010313 CTGCTATTTTTTTTTAAAGATGG - Intronic
1042009197 8:64220971-64220993 CTCCAATTTTTTTGAGGAAAGGG - Intergenic
1042413921 8:68497821-68497843 CTTCTATTTTTGGGGGGAGATGG + Intronic
1042890885 8:73608972-73608994 CTTCTCTTTTTTTTTGAAGATGG - Intronic
1042911269 8:73829235-73829257 CGTTTATTTTTTTGGGAGGATGG - Intronic
1044484072 8:92729415-92729437 CTACTATATTTTTGGGAAGATGG - Intergenic
1044638004 8:94346663-94346685 CTCACATTGTATTGGGAAGATGG + Intergenic
1044993276 8:97815569-97815591 TTTTTTTTTTTTTGGGAAGACGG + Intronic
1045302002 8:100919447-100919469 TTCCTATTTTTTCTGGGAGAGGG - Exonic
1045588579 8:103566465-103566487 TTCCTACTTTGTTGGGAAAATGG + Intronic
1045626358 8:104056397-104056419 CTCCTTTTTTTTTTTTAAGATGG - Intronic
1045683101 8:104683502-104683524 CTCCAATTTATTTGGGTAAATGG - Intronic
1045684977 8:104702530-104702552 CTCCTATTTTTTAAAAAAGAGGG - Intronic
1045985814 8:108248699-108248721 CTCCCTTTTCTTTGGCAAGATGG - Exonic
1047505057 8:125472980-125473002 TTTGTATTTTTTTGTGAAGACGG + Intergenic
1047780708 8:128108727-128108749 CTTTTCTTTATTTGGGAAGATGG + Intergenic
1048012719 8:130471194-130471216 CTTCCCTTTTTGTGGGAAGAGGG - Intergenic
1048032056 8:130642076-130642098 GTAGTTTTTTTTTGGGAAGAGGG + Intergenic
1051872896 9:21759186-21759208 CCCCTTTTTTTCTGGGGAGAGGG + Intergenic
1054460655 9:65460565-65460587 CTTCACTTTTTTTGGGAAGTAGG - Intergenic
1054902687 9:70386602-70386624 CACCTATTTTTTGGGGAAAAAGG - Exonic
1054960014 9:70957542-70957564 CTCATATTTTTTTTTGAAGATGG + Intronic
1057967584 9:99519112-99519134 TTTCTTTTTTTTTGGGAGGAGGG - Intergenic
1058034914 9:100240524-100240546 CGCCTATATTTTTGGGGAGGAGG + Intronic
1058503234 9:105643736-105643758 CTCCTATTTTTTTCCCAAAAGGG - Intergenic
1059148892 9:111929053-111929075 ATCCTATTTTTTTGGGGGGTGGG - Intronic
1059471900 9:114511379-114511401 CTCTTTTTTTTGTGGGGAGATGG - Intergenic
1059845240 9:118268285-118268307 CTCCTCTTTTCTGGGGAGGAGGG + Intergenic
1061631642 9:131875781-131875803 TTTTTATTTTTTTGGGGAGATGG + Intronic
1203581628 Un_KI270746v1:12210-12232 ATCCTATTTTTTTTTTAAGATGG + Intergenic
1186836414 X:13442867-13442889 CTCCAATTTTTTTGGAAAACTGG + Intergenic
1187306113 X:18096672-18096694 AGCCTATTCTTTTGGGAAAAGGG + Intergenic
1187612151 X:20954684-20954706 CTCTAATTTATTTGTGAAGAAGG - Intergenic
1187955153 X:24510401-24510423 CTTTTATTATTTTGGGAAAATGG - Intronic
1189133972 X:38530137-38530159 CTACAACCTTTTTGGGAAGAAGG + Intronic
1189595392 X:42559580-42559602 CTCCTGTTCTTTTTTGAAGAAGG - Intergenic
1190032109 X:46983818-46983840 CACCAATTTTGCTGGGAAGAGGG + Intronic
1192012394 X:67288985-67289007 CTCTTGTTTATTTGTGAAGAAGG - Intergenic
1192288332 X:69762955-69762977 TTCCTATTTTTCTGGGCACAAGG - Intronic
1192413130 X:70952747-70952769 TTTTTATTTTTTTGGAAAGATGG - Intergenic
1192772712 X:74208986-74209008 GTCATAATTTTTTGTGAAGATGG + Intergenic
1195698134 X:107681993-107682015 CTCTTATTTTTTTTTTAAGATGG - Intergenic
1195724810 X:107903630-107903652 CTGCTGTTCTTTTGGAAAGAGGG - Intronic
1195898284 X:109771281-109771303 CTAATATTTTTTTGTGGAGATGG - Intergenic
1196297264 X:114012488-114012510 TTCTTATTTTTTTGTGGAGATGG - Intergenic
1196685509 X:118506912-118506934 TTTTTATTTTTTTGGAAAGACGG - Intronic
1196698424 X:118639195-118639217 CTCTGATGTTTTTGAGAAGAAGG + Intronic
1197345934 X:125325976-125325998 CTCCTGTATGTTTGGGAATATGG + Intergenic
1197524581 X:127546043-127546065 ATCATATTTATTTGGGAATAGGG + Intergenic
1199813151 X:151370955-151370977 GTCTTATTTATTTGGGAACAAGG - Intergenic
1201181509 Y:11352148-11352170 TTCTTATTTTCTTGTGAAGATGG - Intergenic
1202112218 Y:21434103-21434125 TTCCTATTTTTTTGTGGAGAGGG - Intergenic