ID: 970334005

View in Genome Browser
Species Human (GRCh38)
Location 4:15014110-15014132
Sequence CCTCTTGCAATGAAGGTAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 119
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 110}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
970334000_970334005 16 Left 970334000 4:15014071-15014093 CCGAGCAATAATTTTACCATGCT 0: 1
1: 0
2: 1
3: 12
4: 162
Right 970334005 4:15014110-15014132 CCTCTTGCAATGAAGGTAGAGGG 0: 1
1: 0
2: 0
3: 8
4: 110
970333998_970334005 23 Left 970333998 4:15014064-15014086 CCATGACCCGAGCAATAATTTTA 0: 1
1: 0
2: 0
3: 6
4: 93
Right 970334005 4:15014110-15014132 CCTCTTGCAATGAAGGTAGAGGG 0: 1
1: 0
2: 0
3: 8
4: 110
970334001_970334005 0 Left 970334001 4:15014087-15014109 CCATGCTATAGAGCAAGATCACA 0: 1
1: 0
2: 2
3: 8
4: 186
Right 970334005 4:15014110-15014132 CCTCTTGCAATGAAGGTAGAGGG 0: 1
1: 0
2: 0
3: 8
4: 110
970333999_970334005 17 Left 970333999 4:15014070-15014092 CCCGAGCAATAATTTTACCATGC 0: 1
1: 0
2: 1
3: 10
4: 114
Right 970334005 4:15014110-15014132 CCTCTTGCAATGAAGGTAGAGGG 0: 1
1: 0
2: 0
3: 8
4: 110

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
970334005 Original CRISPR CCTCTTGCAATGAAGGTAGA GGG Intronic
901200899 1:7466908-7466930 CCTCTTGCAATCCAGCTGGAAGG - Intronic
910202289 1:84712290-84712312 CCTCTTGGAAAGAAGCTAAATGG + Intergenic
911093864 1:94039859-94039881 CCTTTGGGAATGAAGGAAGAAGG + Intronic
912749750 1:112276721-112276743 CCTCTTACAATGAAGAGAAATGG + Intergenic
916873215 1:168939788-168939810 CATCTTGCAATGCAGGGAAAAGG - Intergenic
917669733 1:177262099-177262121 CCTTTTGCTATGAAGGCAAATGG + Intronic
918148789 1:181780822-181780844 CGTCTTGCACTGAAGGTGGTGGG - Intronic
918606113 1:186428154-186428176 TCTCTAGCTATGAAAGTAGATGG + Intergenic
919025348 1:192161983-192162005 CCTCTGCCAATGAAAGTAGATGG + Intronic
923428203 1:233892711-233892733 GCTCTGGCAAAGGAGGTAGAGGG + Intergenic
1069533672 10:69237633-69237655 CCTGTTGCAGGGAAGGTGGATGG - Intronic
1077681051 11:4240257-4240279 CCTCTTGCAGTGTGGGTAGCAGG - Intergenic
1077685336 11:4285699-4285721 CCTCTTGCAGTGTAGGTAGCAGG - Intergenic
1085959864 11:81449015-81449037 ACTCTTGCAAGAAAGGAAGAAGG + Intergenic
1087202174 11:95356850-95356872 CCTCTAGGAATGCAGGTACATGG - Intergenic
1089153753 11:116385107-116385129 GCTCTTGCCATGAAGGCAGCTGG - Intergenic
1089895672 11:121928066-121928088 CCAATTGTGATGAAGGTAGAGGG + Intergenic
1090931565 11:131302135-131302157 CATCTTGGTATGAAGGAAGATGG - Intergenic
1091293521 11:134456133-134456155 CCTCCTAAAATGCAGGTAGATGG - Intergenic
1092374859 12:7947182-7947204 CTTCTAGGAATGTAGGTAGATGG + Intergenic
1098179841 12:67834084-67834106 CTTATTGCAAAGAAGGTAAATGG + Intergenic
1098613907 12:72498575-72498597 CCTCCTTCAATGAAGGCAGGAGG + Intronic
1102991350 12:117318604-117318626 CCTCTTGCACGGAAGGAAAAGGG + Intronic
1105900574 13:24748250-24748272 CCTCTGCTAATGAGGGTAGAAGG + Intergenic
1106328254 13:28715417-28715439 CCTCTTGGACTGAGGGAAGACGG - Intronic
1111620827 13:90723285-90723307 CCTCTTGCAATGAAAGATGGGGG + Intergenic
1114072964 14:19129902-19129924 CCTCTTGCAGTTGAGATAGAGGG + Intergenic
1116898513 14:50340077-50340099 CCTCTGGCACTGGAGGAAGAAGG - Intronic
1119119495 14:72061058-72061080 CCTCCTCCTCTGAAGGTAGATGG + Intronic
1120173869 14:81273551-81273573 ACTCTTGGGATGAAGGTAGGAGG + Intronic
1123977716 15:25568702-25568724 ATCCTTGCAATGAAGGTAGAAGG - Intergenic
1125347815 15:38736775-38736797 CCTCCTGCCATGAATGAAGAAGG - Intergenic
1127314354 15:57780770-57780792 TCTCTTGCAATGATGCTAGCTGG + Intronic
1130230905 15:82096132-82096154 CCTCTGGCACTGAAGGAAAATGG - Intergenic
1138523599 16:57588293-57588315 CATGATGCAATGAAGTTAGAGGG + Intronic
1140025283 16:71284012-71284034 GCTCCCGCAATGAATGTAGAAGG + Exonic
1141809650 16:86367030-86367052 CCTATTGTAATGAAGGGATAAGG - Intergenic
1148572263 17:48679479-48679501 CATCTTATAATGAAGGTAGGAGG - Intergenic
1149208676 17:54278581-54278603 ACTCTGTCACTGAAGGTAGATGG - Intergenic
1152412524 17:80135347-80135369 CCTCTTCAAAGGAAGGGAGACGG + Exonic
1156432650 18:37092317-37092339 CCTCTGGCAACGGTGGTAGATGG - Intronic
1157393172 18:47320007-47320029 GCTCCTGCAAGGAAGATAGAAGG + Intergenic
1158616535 18:58992762-58992784 CCTCTTGCAATGAGAGGAAATGG - Intergenic
1159002607 18:62987478-62987500 CCATTAGCAATGAGGGTAGAAGG + Intergenic
1162547064 19:11337190-11337212 CCTCTTGTCATGGCGGTAGACGG + Exonic
1163883413 19:19946443-19946465 TCTGATGCAGTGAAGGTAGATGG - Intergenic
1165277303 19:34766034-34766056 CCTCTTTCAATGAGTGGAGAAGG - Intronic
1166740313 19:45110723-45110745 CCTCTTGTTATGAAGGAGGAAGG + Intronic
1167313071 19:48748481-48748503 CCTCTCACAATGAAGGAAGTTGG - Exonic
926665068 2:15512660-15512682 CCGCTGGCTTTGAAGGTAGAAGG + Intronic
927704223 2:25287062-25287084 CCTCCTGCACTCAAGCTAGAGGG + Intronic
929665385 2:43829991-43830013 TCTCTTGCCATCAGGGTAGAAGG + Intronic
929967370 2:46545194-46545216 CATCCTCCAATGAAGGTAGAAGG - Intronic
931275813 2:60743003-60743025 GCTCTTCCAATGAAGTTAGTGGG + Intergenic
932447920 2:71791945-71791967 CCTCTTTCCAAGAAGGAAGAGGG - Intergenic
933301741 2:80548279-80548301 CCTATTGATTTGAAGGTAGAAGG - Intronic
940896558 2:159086609-159086631 CCTCTGGAAATAAAGGGAGATGG + Intronic
940921718 2:159315125-159315147 CCTCTTCCATTGATGGTAGGAGG + Intergenic
940957772 2:159748099-159748121 CTTCTGACAATGAAGGTAGGCGG + Exonic
946480376 2:220050070-220050092 AGCCTTTCAATGAAGGTAGAGGG + Intergenic
1170962956 20:21041643-21041665 CCTCAGGAAATGAAGGGAGAGGG + Intergenic
1172025272 20:31944124-31944146 CCTCATGCTCTGAAGGCAGAAGG - Exonic
1177741571 21:25160337-25160359 CCTGTTGCAGGGAAGGTAGTTGG + Intergenic
1178627560 21:34230998-34231020 CCTCAGGCAAGGAAGGCAGATGG - Intergenic
1179494021 21:41760408-41760430 CCTCTTGAAAGGAAGGTCCAGGG + Intronic
956496912 3:69837217-69837239 CCCCTTCTAATGAATGTAGAGGG - Intronic
957017937 3:75091625-75091647 CATCTTGAAATGGAGGAAGATGG - Intergenic
962240710 3:133748553-133748575 CCTGATGCAATCAAGGTAGGAGG - Exonic
963959533 3:151293678-151293700 ACTATAGAAATGAAGGTAGAGGG - Intronic
964446160 3:156760888-156760910 CCTCTTTAAATTAAGGAAGAGGG - Intergenic
965375688 3:167921040-167921062 CCTCTTCCAAGGAAGGCACATGG - Intergenic
966357495 3:179096478-179096500 CCTCTTGCTATGACGAGAGAGGG + Intergenic
966790485 3:183664987-183665009 CCTCTCTCAATAAAGGCAGATGG + Exonic
967427942 3:189349051-189349073 GCTCTTGCAAAGAAGACAGAAGG + Intergenic
968294242 3:197561393-197561415 CCTCTTTCCATGACGATAGAAGG + Intronic
969131152 4:4991951-4991973 CCTCTTGGGAAGAAAGTAGAGGG - Intergenic
969707300 4:8818949-8818971 CCTCTTGGTAAGAAGGTAGAGGG + Intergenic
970071773 4:12167393-12167415 TCTTTTGCTGTGAAGGTAGAAGG - Intergenic
970334005 4:15014110-15014132 CCTCTTGCAATGAAGGTAGAGGG + Intronic
976518329 4:85997235-85997257 CCACAAGCATTGAAGGTAGATGG + Intronic
984574619 4:181433602-181433624 CCTCTGGAAATGAAGGAGGAAGG - Intergenic
984642261 4:182180455-182180477 CCAGATGCTATGAAGGTAGATGG - Intronic
984802355 4:183726779-183726801 CCTCTTGCAGTTGAGATAGAAGG - Intergenic
987093946 5:14531970-14531992 ACTCTTCCAACGAAGGTGGATGG + Intronic
991034465 5:62114170-62114192 CCTCCTGCAATGAGAGTAGCAGG - Intergenic
994347272 5:98701263-98701285 CCTGCTTCAATGAAGGTAGCAGG - Intergenic
994385652 5:99128353-99128375 CCTCATACAATCAAGGCAGACGG - Intergenic
995964559 5:117888912-117888934 CCTCTTGCTCTGAAGATAAAAGG - Intergenic
996331844 5:122338279-122338301 CCTTTTGAAATGCAGATAGAGGG + Intronic
1008652758 6:53579881-53579903 ACTCTACCAAAGAAGGTAGATGG - Intronic
1009193737 6:60660441-60660463 CCTCTTGCAGTTGAGATAGAAGG + Intergenic
1009292766 6:61904700-61904722 CCTGGTGCAATGAAGTTATAAGG - Intronic
1011085734 6:83538356-83538378 CCCCTTGCAATAAAGATAAAGGG - Intergenic
1019672558 7:2289473-2289495 CCTCCTGGAATGAGGGAAGACGG - Intronic
1019817445 7:3211479-3211501 GCTCTTGCAATGGAGGGAGGGGG + Intergenic
1021010527 7:15458851-15458873 CATCTTGCAATGGTGGTAGAGGG - Intronic
1024085726 7:45889985-45890007 CCTCTTGCCATGGGGGTGGAGGG + Intronic
1029223230 7:99006760-99006782 CTTGTTGCAATGAAGTTGGAGGG - Intronic
1029663935 7:101982112-101982134 CAGCCTGCAATGCAGGTAGAGGG - Intronic
1030547944 7:110921421-110921443 CCTCTTGCTTTGATGTTAGATGG - Intronic
1033008136 7:137589789-137589811 CCCCTTCCAAAGAAGGAAGAAGG + Intronic
1035910090 8:3556818-3556840 CCTATGGCAGTGAAGGGAGAGGG - Intronic
1036724124 8:11203969-11203991 CTTCTTCCAAAGAAAGTAGAAGG - Intergenic
1036795714 8:11755055-11755077 CCTCTTGCAATGCGGAAAGAGGG + Exonic
1037799932 8:22027201-22027223 CCTCATGCACTGAGGGTGGAGGG + Intronic
1041754197 8:61295450-61295472 CATCTTCCAATGAAGGAAGGAGG + Intronic
1041849375 8:62371931-62371953 CCTTTGGCAAAGAAGGTAAATGG - Intronic
1046830025 8:118734917-118734939 CCTCCTGCAACTAAGGTACAAGG + Intergenic
1047411781 8:124630144-124630166 CCTCTTCCAGGGGAGGTAGAGGG - Intronic
1052270280 9:26621210-26621232 CCTCATGGAATTAAGGTAGGAGG + Intergenic
1057014274 9:91637129-91637151 CCTCATATACTGAAGGTAGAAGG - Intronic
1058154556 9:101500663-101500685 CCTTTTGAAAAGAAGGTAGATGG + Intronic
1059524068 9:114973630-114973652 GCTAATGCAATGAAGGTACATGG - Intergenic
1186047971 X:5556793-5556815 CAACTTGCAATCAAGGTGGAAGG - Intergenic
1186944689 X:14552723-14552745 CCTCAGGCAATGGAGGTAGAAGG - Intronic
1189502754 X:41579003-41579025 CTTGTTCAAATGAAGGTAGACGG + Intronic
1191210707 X:57882328-57882350 CCTTTTGCAAGGAAAATAGAGGG + Intergenic
1200334648 X:155336721-155336743 ACTCTTGCAATGAATTCAGAGGG + Intergenic
1200351818 X:155504500-155504522 ACTCTTGCAATGAATTCAGAGGG - Intronic