ID: 970334161

View in Genome Browser
Species Human (GRCh38)
Location 4:15016229-15016251
Sequence GTGTATACACATATGTAACT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 255
Summary {0: 1, 1: 0, 2: 0, 3: 23, 4: 231}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
970334155_970334161 13 Left 970334155 4:15016193-15016215 CCTGTATCCCCCACGTATACATA 0: 1
1: 0
2: 1
3: 8
4: 364
Right 970334161 4:15016229-15016251 GTGTATACACATATGTAACTGGG 0: 1
1: 0
2: 0
3: 23
4: 231
970334156_970334161 6 Left 970334156 4:15016200-15016222 CCCCCACGTATACATAAGCTTAC 0: 1
1: 0
2: 0
3: 4
4: 39
Right 970334161 4:15016229-15016251 GTGTATACACATATGTAACTGGG 0: 1
1: 0
2: 0
3: 23
4: 231
970334157_970334161 5 Left 970334157 4:15016201-15016223 CCCCACGTATACATAAGCTTACA 0: 1
1: 0
2: 0
3: 4
4: 66
Right 970334161 4:15016229-15016251 GTGTATACACATATGTAACTGGG 0: 1
1: 0
2: 0
3: 23
4: 231
970334159_970334161 3 Left 970334159 4:15016203-15016225 CCACGTATACATAAGCTTACACA 0: 1
1: 0
2: 0
3: 4
4: 79
Right 970334161 4:15016229-15016251 GTGTATACACATATGTAACTGGG 0: 1
1: 0
2: 0
3: 23
4: 231
970334158_970334161 4 Left 970334158 4:15016202-15016224 CCCACGTATACATAAGCTTACAC 0: 1
1: 0
2: 0
3: 1
4: 63
Right 970334161 4:15016229-15016251 GTGTATACACATATGTAACTGGG 0: 1
1: 0
2: 0
3: 23
4: 231

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
970334161 Original CRISPR GTGTATACACATATGTAACT GGG Intronic
902049429 1:13550183-13550205 ATGTATATACATATATAAATGGG - Intergenic
902913705 1:19622184-19622206 GTGTATACATATACGTAGCAGGG + Intronic
904205728 1:28854063-28854085 CTATATACATATATGTAATTTGG + Intronic
905602106 1:39261801-39261823 GTGTATACATGTATATACCTAGG + Intronic
907193816 1:52670141-52670163 GTGTATAAACATATTTTTCTAGG - Intergenic
908096821 1:60747909-60747931 ATGTATACACATACATAACATGG - Intergenic
908741483 1:67333342-67333364 ATGTGTACTCATATGTAACTTGG + Intronic
910054707 1:83018889-83018911 ATGTATACACATATATAGCAGGG - Intergenic
910502304 1:87906722-87906744 GTGTGTACATATATGTAGGTAGG - Intergenic
910744561 1:90559239-90559261 GTGAATACATATAAGAAACTGGG - Intergenic
912207595 1:107525579-107525601 GTGTATACACAGATGGAAGTTGG + Intergenic
912461916 1:109840084-109840106 ATATATAAACATATGTATCTAGG + Intergenic
918532530 1:185539009-185539031 GTGTATACATATATGTATATCGG - Intergenic
919043255 1:192419953-192419975 GTGTATATACATATGTAGGTAGG + Intergenic
919105951 1:193150979-193151001 GTACATACACATTTATAACTTGG - Intronic
919530043 1:198705719-198705741 GTGTTTACAAATCTGTAAGTGGG - Intronic
921525569 1:216212703-216212725 GTGCATGCACATATGTATGTAGG + Intronic
923835616 1:237608011-237608033 GTGTATACATATGTGTATATAGG - Intronic
1063926553 10:10983433-10983455 GAGTAAACACATATATAACATGG + Intergenic
1063939491 10:11112422-11112444 GTGTGTACATATACGTCACTAGG - Intronic
1064672077 10:17725390-17725412 GTGTATACATATATATATATAGG + Intergenic
1064777336 10:18793291-18793313 ATGTATACACATATATAAAGAGG + Intergenic
1066046801 10:31602360-31602382 GAATATATACATATATAACTTGG + Intergenic
1066627376 10:37420693-37420715 GTATATACACATATATATTTAGG - Intergenic
1067360818 10:45576574-45576596 GTGTATACATAGATGTTGCTAGG + Intronic
1068249285 10:54416122-54416144 GTGTATATATATATTTAGCTTGG - Intronic
1068328879 10:55534972-55534994 GTGTATTCACATTTATAAGTGGG + Intronic
1069006550 10:63323830-63323852 GTGTATACATATATATATATAGG + Intronic
1070063379 10:73008472-73008494 GTGTGTACACATATGTATATAGG - Intronic
1073877435 10:107941266-107941288 GTGTCTACCCATATGTCCCTGGG - Intergenic
1074730092 10:116362231-116362253 GTGTGTACACACATGTACATAGG + Intronic
1075404384 10:122184707-122184729 GTGAATATACATATGTATTTAGG + Intronic
1077618250 11:3694960-3694982 GTATATACAAACATGTAAATAGG + Intronic
1078238477 11:9508161-9508183 TTGTATTGACATATCTAACTAGG + Intronic
1078263136 11:9730472-9730494 GTGCATACACACATATACCTTGG - Intronic
1079462844 11:20699326-20699348 GTGTATACATATATATACCTTGG - Intronic
1079630583 11:22669085-22669107 ATATATACACATATGTGACATGG - Intronic
1079645807 11:22862732-22862754 GTGTGTACAGATAAGTAACATGG + Intergenic
1080315659 11:30945383-30945405 GTGCATATATATATATAACTTGG - Intronic
1082755945 11:57076541-57076563 GTGTATACACACATATATGTGGG + Intergenic
1085657922 11:78333566-78333588 GTGTATAAAAATATGCCACTGGG - Intronic
1088314538 11:108494584-108494606 GTCTTTACACATAAGAAACTGGG - Intronic
1088572820 11:111240269-111240291 GTGTATATACATATGTGTATGGG - Intergenic
1088589034 11:111386590-111386612 GTGTATATACATATTTTCCTTGG + Intronic
1088664089 11:112076799-112076821 GTGTAACCACCTATGTGACTGGG + Intronic
1092014453 12:5146533-5146555 GTGTATACATATATATGAATAGG - Intergenic
1092382393 12:8007833-8007855 GTGTATATATATATTTAAATAGG - Intergenic
1092582481 12:9858686-9858708 GTGTATATATATATGTATATAGG + Intronic
1093833547 12:23797315-23797337 GGATATACACAGATGTATCTTGG + Intronic
1095245751 12:39919141-39919163 GTGTATACATATATGTATGCAGG - Intronic
1096945117 12:55397313-55397335 ATATATACACATATGTATATAGG + Intergenic
1097802439 12:63929079-63929101 TTGTGTACACACATGTAACCAGG - Intronic
1098561325 12:71876312-71876334 GTCAACACACATATGTAAATTGG - Intronic
1099248684 12:80225006-80225028 GTGTATATACATATATATATGGG - Intronic
1100215532 12:92444142-92444164 ATATATACACATATGTAAGATGG - Intergenic
1100265297 12:92970109-92970131 GTGTATAAACATCTATAAATTGG - Intergenic
1100511637 12:95280453-95280475 GTGTGTACACATATGAAAGGGGG - Intronic
1100511643 12:95280508-95280530 GTGTGTACACATATGAAAGGGGG - Intronic
1102176362 12:110878219-110878241 GTGTATACATATATGCATATAGG - Intronic
1102749938 12:115283882-115283904 GTGTATATATATATATATCTGGG - Intergenic
1104359588 12:128120091-128120113 GTGTGTACACATATGTTTATGGG + Intergenic
1105873721 13:24534953-24534975 GTGTATATATATATGTATATGGG + Intergenic
1106125735 13:26898552-26898574 GAGGAGACACATATGTAGCTGGG + Intergenic
1107414177 13:40186062-40186084 GTGTATATATATATGTATGTTGG + Intergenic
1107704166 13:43082910-43082932 GTGTATATATATATGAAATTTGG + Intronic
1108039947 13:46330785-46330807 GTGCATACACCTATGTCACTCGG + Intergenic
1109550424 13:63890772-63890794 GTGTATATATATATATATCTGGG + Intergenic
1110110013 13:71734100-71734122 GTGTATATATATATGTATATGGG + Intronic
1112258834 13:97859198-97859220 GCGTATACATATATATAATTGGG - Intergenic
1112647491 13:101351004-101351026 GTATATACATATATGTATGTTGG - Intronic
1112818838 13:103307005-103307027 GTGTATATATATATGTATATAGG + Intergenic
1113060061 13:106313440-106313462 CTGCATACACATATATACCTAGG - Intergenic
1113194831 13:107790213-107790235 GTGTATTTACATATACAACTTGG + Intronic
1113907108 13:113824618-113824640 GTGTGTACACATTTGTGACTGGG + Intronic
1113976728 13:114233067-114233089 GTGTGTATACATATATGACTGGG - Intergenic
1114137798 14:19872464-19872486 GTGTATATATATATATAAATAGG - Intergenic
1114137800 14:19872526-19872548 GTGTATATATATATATAAATAGG - Intergenic
1114396583 14:22368632-22368654 ATGTATACACATATATACCATGG + Intergenic
1115370924 14:32613800-32613822 GTGTATACACATGTTTAAAATGG + Intronic
1115663152 14:35517340-35517362 ATTAATACAAATATGTAACTGGG + Intergenic
1117325398 14:54664310-54664332 GTGTATACTCATCTCAAACTTGG - Intronic
1120351947 14:83372718-83372740 GTGTATATAGATATGCAAGTGGG + Intergenic
1121056057 14:90854017-90854039 GTGTATACACACATGTATTGGGG - Exonic
1121191087 14:92030759-92030781 GTGTGTACACAAAGGCAACTGGG + Intronic
1126829138 15:52581888-52581910 GTGTAAACACTAATCTAACTGGG + Exonic
1128042830 15:64590686-64590708 ATGTATATATATATGTATCTGGG + Intronic
1128269498 15:66296088-66296110 GTGTATAAACATCTATATCTTGG - Intronic
1129131248 15:73498814-73498836 TTTTATACACATATGCAACAAGG - Intronic
1129920803 15:79317654-79317676 GTGTATACATGTATGTATCATGG - Intronic
1130797341 15:87223930-87223952 GTCTATTCACATAAGGAACTGGG + Intergenic
1131508494 15:93036082-93036104 GTGTAATCACACATGTGACTCGG + Intronic
1131636916 15:94245065-94245087 GTGTATACATATACGTAAACAGG - Intronic
1133632582 16:7635613-7635635 GAGTATACACAGATGTTACATGG + Intronic
1137812605 16:51367202-51367224 GTGTATATACACATATAACAAGG + Intergenic
1141032935 16:80605288-80605310 GTATAAACACATATGTATATAGG + Intronic
1143689990 17:8553437-8553459 GTGTATGCACATATATACCCAGG - Intronic
1147489863 17:40855935-40855957 GTATTTACACAAATGGAACTTGG - Intergenic
1148404852 17:47402322-47402344 GTTTATACGCAGATGAAACTTGG + Intronic
1150054450 17:62000596-62000618 ATGTATGCACATATGTACTTTGG + Intronic
1150461867 17:65360487-65360509 GTGCATACATGTATGTAAGTGGG + Intergenic
1150662834 17:67099724-67099746 GTGTATATAAATAGATAACTGGG + Intronic
1153502476 18:5763120-5763142 GTGCATACAGATATGTGAATAGG - Intergenic
1155579625 18:27288318-27288340 GTGCTTCCACATATGAAACTGGG - Intergenic
1155627191 18:27847944-27847966 GTGTTTGCAGATAAGTAACTTGG - Intergenic
1157073928 18:44443931-44443953 GTGTATACAGTTATGTTACTTGG - Intergenic
1159176923 18:64848747-64848769 TTGTATACACATGTATCACTTGG - Intergenic
1160343111 18:78106933-78106955 GTGTATGCACATATGTATGCAGG - Intergenic
1164499536 19:28805605-28805627 ATATATACACATATGTATATAGG + Intergenic
1166352996 19:42209437-42209459 CTGAATACACAAATGAAACTAGG + Intronic
927615180 2:24586777-24586799 TTTTCTACACATATGCAACTTGG + Intronic
929260202 2:39858807-39858829 ATGTGTACACTTATGTAACCAGG + Intergenic
930274272 2:49293453-49293475 GTGTATACACAAATATTAGTTGG - Intergenic
930905460 2:56561263-56561285 ATGGATACACATAAGAAACTCGG - Intergenic
932081992 2:68723820-68723842 GTGTAGACACATCTGATACTGGG + Intronic
932193776 2:69765057-69765079 GTGTATACACATATATACAGTGG - Intronic
933466653 2:82659674-82659696 GTGTACACACATATCTAACCAGG + Intergenic
936095983 2:109530523-109530545 GTGTCTATACATATCTATCTTGG + Intergenic
936665841 2:114594414-114594436 GTGAATACATATATGTAAAAGGG + Intronic
936723583 2:115284713-115284735 GGTTATACACCTATGTATCTAGG + Intronic
936980405 2:118259430-118259452 CTGTATATAGAAATGTAACTTGG + Intergenic
937457987 2:122060184-122060206 GTGTATATATATATATAAATAGG + Intergenic
937561808 2:123233483-123233505 GAGTATACACAGTTATAACTGGG - Intergenic
939721331 2:145656185-145656207 GTGTATACATATATGTATAAAGG - Intergenic
940199362 2:151133026-151133048 GTGTATACACACATGCAAGGTGG - Intergenic
940377899 2:152977594-152977616 GGGTATACCCATATGTACTTGGG + Intergenic
940896974 2:159090211-159090233 GTGTATCTACATATGTATGTAGG - Intronic
941336459 2:164250259-164250281 AAGTATAGACATATGTCACTGGG + Intergenic
941356125 2:164494605-164494627 GTGTATGCATAAATGTAGCTGGG + Intronic
941629478 2:167867981-167868003 GTTTATAGGCAAATGTAACTAGG + Intergenic
941652263 2:168104761-168104783 GGGTATATACATTTGTAATTTGG - Intronic
943937071 2:193933402-193933424 GTGTATATACATATGTATCATGG + Intergenic
944016129 2:195041083-195041105 GTGCATACACATATGTGCCCTGG - Intergenic
945875703 2:215275955-215275977 ATATATATACATATTTAACTGGG + Intergenic
947102609 2:226637522-226637544 TTGGATAAACATATGTAATTGGG - Intergenic
1169544506 20:6636897-6636919 GTGTGTACACATATTTTTCTGGG + Intergenic
1170003469 20:11640623-11640645 GTGTGTACACATAAGTATATGGG - Intergenic
1170695913 20:18658628-18658650 ATGTAAACACACAGGTAACTTGG + Intronic
1172440180 20:34960005-34960027 GTGTTCCCACATATGTACCTTGG + Intergenic
1174317704 20:49715171-49715193 GTGTAGACATATCTGAAACTAGG + Intergenic
1174856885 20:54054374-54054396 GTGTATACATATATGTATAGAGG - Intronic
1174898897 20:54477409-54477431 GAATATATACATATGTAATTAGG + Intronic
1176701764 21:10061554-10061576 GTATATACATATATGTATATAGG - Intergenic
1178572145 21:33748702-33748724 GTATATATATATATGAAACTGGG + Intronic
1178910922 21:36672815-36672837 GTGTATACATATATATATATAGG - Intergenic
1180738398 22:18035725-18035747 GTGTATACACATATGTTTGCTGG + Intergenic
1181927451 22:26371470-26371492 GAATATACACAAATGTAGCTGGG + Intronic
949118088 3:353491-353513 ATGAATACAGATATTTAACTTGG + Intronic
950989388 3:17416518-17416540 ATGCATACTCATATATAACTGGG + Intronic
951459790 3:22938786-22938808 GTCTATAAATATATATAACTGGG + Intergenic
951531161 3:23699314-23699336 GTGAAAACACAAATGTACCTGGG - Intergenic
951878623 3:27458217-27458239 GTGTATACAGATTTGTTTCTTGG + Intronic
952539506 3:34352776-34352798 GTGTTTATAAATATGTAACCTGG + Intergenic
953268278 3:41414334-41414356 GTGAATACACACATACAACTTGG + Intronic
956160679 3:66348370-66348392 GTGCACACACATATGTATCTAGG + Intronic
957458368 3:80483494-80483516 GTGTATATATATATGTACATAGG - Intergenic
959790948 3:110360367-110360389 GTGTATATATATATGGAACTTGG + Intergenic
959969031 3:112387627-112387649 TTCTATACACATAAGTAATTGGG - Intergenic
960554449 3:119011967-119011989 GTGTATACACACATATATATAGG + Intronic
964098496 3:152962096-152962118 GTGTATACATACATGTACATAGG + Intergenic
970334161 4:15016229-15016251 GTGTATACACATATGTAACTGGG + Intronic
972719864 4:41685217-41685239 GTCTATACACATATTTACCTGGG + Intronic
973127328 4:46603756-46603778 GTATATACATATATGTATTTGGG + Intergenic
974696186 4:65376067-65376089 GTGTATACAGATGTGCAAATGGG - Intronic
977018442 4:91726181-91726203 ATGTATACACATATATGAATGGG - Intergenic
978302498 4:107287137-107287159 GTATATACATATATATAAGTAGG + Intergenic
978396766 4:108289052-108289074 GTGTAAAAACATCTTTAACTGGG + Intergenic
978783472 4:112581907-112581929 TTGTATACATGTATGAAACTAGG - Intronic
979863141 4:125719558-125719580 ATATATATATATATGTAACTTGG + Intergenic
982897181 4:160946662-160946684 GTGTGTACACATATATATTTGGG - Intergenic
983779989 4:171657103-171657125 ATGTATATACATATGTATATAGG - Intergenic
986018861 5:3782076-3782098 CTGTATACACATTTGCAACTTGG + Intergenic
986931617 5:12831120-12831142 GTGTGTACACATATGCATTTAGG - Intergenic
987151692 5:15047028-15047050 ATGTATACATATATGTATATGGG - Intergenic
987987447 5:25165730-25165752 GAATACCCACATATGTAACTGGG + Intergenic
988010897 5:25484325-25484347 ATACATATACATATGTAACTAGG + Intergenic
989232189 5:39099387-39099409 GTGTTTCAACATATGAAACTTGG - Intergenic
989807449 5:45627015-45627037 GTGTACATATATATATAACTGGG + Intronic
990425432 5:55683574-55683596 GTGTGTACATATATGTGTCTAGG - Intronic
990977774 5:61574332-61574354 GTGTATGCACATATGTGCATGGG - Intergenic
991318156 5:65335864-65335886 GTGAATACACATAGAAAACTAGG + Intronic
994123102 5:96139485-96139507 GTGTATATATATATGTTACAAGG - Intergenic
994152428 5:96463119-96463141 CTGTATACACATGTCTACCTGGG - Intergenic
995519209 5:112985204-112985226 GCATGTACACATATGTAATTAGG - Intronic
995744143 5:115386145-115386167 GTGTTTTCACATAGTTAACTGGG - Intergenic
997507520 5:134429750-134429772 GAATATATACATATGTAATTTGG - Intergenic
997652279 5:135531302-135531324 GTGTATACAAATATATATGTTGG + Intergenic
998676168 5:144410423-144410445 ATGTAACCTCATATGTAACTAGG + Intronic
999894577 5:156016674-156016696 GTGTTTACTTAAATGTAACTTGG + Intronic
1004731210 6:18360950-18360972 AAGTATACATGTATGTAACTGGG - Intergenic
1008683265 6:53896985-53897007 GTATTTCCACAGATGTAACTTGG + Intronic
1009283747 6:61785539-61785561 GTGTATATGCATATGAAAATTGG + Intronic
1010451320 6:76006456-76006478 GTGTATATACATATGTATATAGG + Intronic
1011954328 6:93006921-93006943 GTGTATGCACTTATTTAATTAGG + Intergenic
1012895183 6:104939975-104939997 ATATATACACATATTTAGCTTGG - Intergenic
1013334661 6:109143558-109143580 GTGTAGACACATATTAAAGTGGG - Intronic
1017967990 6:159283397-159283419 GTATATACATATATGTATATAGG - Intergenic
1017967991 6:159283423-159283445 GTATATACATATATGTATATAGG - Intergenic
1017967992 6:159283449-159283471 GTATATACATATATGTATATAGG - Intergenic
1017967995 6:159283527-159283549 GTATATACATATATGTATATAGG - Intergenic
1020553219 7:9634570-9634592 GTGTACATACATATATATCTTGG + Intergenic
1020791142 7:12629816-12629838 GTGTATGCACATAAATTACTTGG - Intronic
1022931320 7:35118219-35118241 GTGTATGCATGTATGAAACTTGG + Intergenic
1023935703 7:44738299-44738321 GTGTTTATACAGATGGAACTGGG - Intergenic
1024159520 7:46660009-46660031 ATGTATACACATATGATACAGGG - Intergenic
1025703528 7:63842174-63842196 GTGTATACACACATATATTTTGG - Intergenic
1027006668 7:74699805-74699827 GTATATACTCATTTGTAAATGGG + Intronic
1027718201 7:81702004-81702026 GTGCATGCACATGTGTACCTAGG + Exonic
1028817117 7:95158576-95158598 GTATATCCACATTTGTAAGTAGG - Intronic
1028935353 7:96457806-96457828 GTGTATACATATATATATTTGGG - Intergenic
1028969373 7:96840425-96840447 GTCTTGACACATAGGTAACTTGG - Intergenic
1029151982 7:98486924-98486946 GTGTGTGCACACATGTATCTGGG + Intergenic
1030865193 7:114693820-114693842 GTGTATACAAATTTATGACTTGG - Intergenic
1030942902 7:115677679-115677701 ATGTATACATATATGTAATGGGG + Intergenic
1033375340 7:140756063-140756085 GAGTAGACAGAAATGTAACTGGG + Intronic
1036192863 8:6687050-6687072 ATATATACACATATATATCTGGG - Intergenic
1036938111 8:13024815-13024837 TTGTATACAAATATTTAATTTGG + Exonic
1037099854 8:15031969-15031991 GTGTATGCAAAAATGAAACTGGG - Intronic
1037153754 8:15673979-15674001 GTGTATGCACATGTGTATATAGG - Intronic
1038763173 8:30403629-30403651 GTGTATACACAGATTTAGCTAGG - Intronic
1040491296 8:47924753-47924775 GTGAATGCACATATATAACTGGG + Intronic
1040706204 8:50131529-50131551 GTGTGTACACATATGTACAATGG - Intronic
1040742506 8:50595555-50595577 ATTTATACACATAAGTACCTGGG + Intronic
1042735468 8:71983087-71983109 GTGTATATATATATATAGCTAGG + Intronic
1043966940 8:86489477-86489499 GTGTATACACATTGGAATCTTGG - Intronic
1044024057 8:87146325-87146347 GTAGACACAAATATGTAACTGGG - Intronic
1046582392 8:116109584-116109606 TTGTATACACAGATATAATTAGG + Intergenic
1050848211 9:10250838-10250860 GTGTATAATCATATGTAAATAGG + Intronic
1051008755 9:12383420-12383442 GTGTATTCTCACATGTAAGTAGG - Intergenic
1051318791 9:15876578-15876600 ATGTAGACACATATGTTACATGG + Intronic
1051378038 9:16424629-16424651 GTGTGTACATATATGTATATGGG + Intronic
1052369003 9:27643611-27643633 ATATATACACATATGTATATGGG - Intergenic
1052962479 9:34311627-34311649 ATATATACACATATGTAAAATGG - Intronic
1053244414 9:36522877-36522899 GTGTATACACACATGGAAAATGG + Intergenic
1054841043 9:69740179-69740201 GTGTATACATATATGTATATAGG + Intronic
1054841056 9:69740388-69740410 GTGTATACACATATGTATACAGG + Intronic
1055107712 9:72529516-72529538 GTGTATATACATATGTGTTTAGG + Intronic
1055245577 9:74238536-74238558 GTACATACATATATGTAACATGG - Intergenic
1056558940 9:87712958-87712980 GTGTATACACATGTATATATGGG + Intergenic
1061060068 9:128245795-128245817 GTGTGTGCACATGTGTATCTGGG - Intronic
1186282829 X:8012566-8012588 TTGTTTCCACATATGTAAATAGG + Intergenic
1187451058 X:19396718-19396740 GTGTAAACACCCATGTATCTGGG - Intronic
1188285785 X:28324181-28324203 CTATATACACAGAGGTAACTAGG + Intergenic
1188404825 X:29795239-29795261 GTGTATAGAGATAGGTAAATAGG - Intronic
1188680581 X:32998596-32998618 GTGTATATATATATATAAATAGG - Intronic
1189015755 X:37094868-37094890 GTGTATACACAGATTTAGCTAGG - Intergenic
1190298277 X:49041266-49041288 GTGTGTACACACATATACCTGGG - Intronic
1191170155 X:57437919-57437941 ATGTATACACATATATACATAGG + Intronic
1194001638 X:88436961-88436983 GTGTGTACACATGGGTAACTTGG + Intergenic
1194303405 X:92214471-92214493 TTGTTTCCACATCTGTAACTTGG + Intronic
1196278802 X:113798922-113798944 GTATATACATATTTGTAATTTGG + Intergenic
1196714240 X:118796196-118796218 GTGAAATCACACATGTAACTCGG - Intergenic
1199088969 X:143668676-143668698 GTATATATCCATGTGTAACTGGG + Intergenic
1199348471 X:146770882-146770904 GTGTATACGAATATAAAACTAGG - Intergenic
1201338498 Y:12905492-12905514 GTGTATACAATTGTGTGACTTGG + Intronic
1201428102 Y:13876045-13876067 GTTTATACATATATGTAGCATGG - Intergenic