ID: 970336498

View in Genome Browser
Species Human (GRCh38)
Location 4:15050850-15050872
Sequence GGACCTTAAACTATAACCCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 105
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 99}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
970336496_970336498 20 Left 970336496 4:15050807-15050829 CCTCATCATTTCTCGCTGGAGTG 0: 1
1: 0
2: 0
3: 7
4: 108
Right 970336498 4:15050850-15050872 GGACCTTAAACTATAACCCATGG 0: 1
1: 0
2: 0
3: 5
4: 99

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
970336498 Original CRISPR GGACCTTAAACTATAACCCA TGG Intronic
900582807 1:3417594-3417616 AGACCTTAAACTACAAACGAGGG + Intronic
903568050 1:24283839-24283861 GGACCTTATTCAATAACCCAGGG + Intergenic
903743490 1:25571943-25571965 GCACCATGAACTATAACCCCTGG - Intergenic
905487345 1:38311856-38311878 TGACTTTAAACTATACCTCAAGG + Intergenic
907594030 1:55703490-55703512 GGCCCTTAGCCTCTAACCCAGGG + Intergenic
911708922 1:101046548-101046570 GGACAGCAAACTATAACCCCTGG + Intergenic
912368049 1:109151044-109151066 GGTCCTTAACCTATGGCCCATGG - Intronic
919222025 1:194641785-194641807 GGACCTTAAACTATACTGCAAGG - Intergenic
920012450 1:202878867-202878889 TGACCTTAAGCTAAACCCCAAGG + Intergenic
921822361 1:219631681-219631703 GGTCAGCAAACTATAACCCAGGG + Intergenic
924192890 1:241573678-241573700 GGACCTTAAATTATACTACAAGG - Intronic
924503451 1:244658246-244658268 GGACCTTTAACTGTCAGCCAGGG - Intronic
1063291598 10:4755497-4755519 TGACCTTAATCTACATCCCACGG + Intergenic
1067707127 10:48615153-48615175 AGACCTGAAACTCTAACCTAAGG + Intronic
1067988388 10:51180127-51180149 GGACCTTCAAATATAATGCACGG + Intronic
1068496647 10:57791552-57791574 GGACTATAAACTGTAAACCAGGG + Intergenic
1068825219 10:61430222-61430244 GGAGCTTGAATTAGAACCCAAGG + Intronic
1072078357 10:92001810-92001832 GGACATTAAAATATACTCCAAGG + Intronic
1073001998 10:100292844-100292866 GGCCCCTAAACTAAAACCAAAGG + Intronic
1074810081 10:117095408-117095430 GTATCTGAAACTAAAACCCAGGG + Intronic
1076659667 10:132047303-132047325 GCACCAGACACTATAACCCATGG - Intergenic
1079119446 11:17671538-17671560 GGTCCTTGAATTATGACCCATGG + Intergenic
1079408198 11:20163375-20163397 GGACCTTAAACCCCAAACCAGGG - Intergenic
1086053930 11:82626362-82626384 TGACCTTAACCTATAAACCGAGG + Intergenic
1087376491 11:97348953-97348975 AGACCTTAAACTGAAATCCAAGG - Intergenic
1087573696 11:99963561-99963583 TGACCTCAAACTATACCACAAGG - Intronic
1091010732 11:131998201-131998223 GGCCCTTAAAATATACTCCAAGG - Intronic
1092316198 12:7416821-7416843 TGACTTTAAACTATACCTCAAGG - Intronic
1094017270 12:25878633-25878655 GGTCAGAAAACTATAACCCATGG + Intergenic
1095527292 12:43142473-43142495 GGAGCCTGAACTGTAACCCAGGG + Intergenic
1111659637 13:91193240-91193262 GGATCTGAAACTGTGACCCATGG - Intergenic
1112324123 13:98432161-98432183 GAACCTAAATCTAGAACCCATGG + Intronic
1114384005 14:22237674-22237696 GGCACTTAGGCTATAACCCAGGG + Intergenic
1118222495 14:63868159-63868181 GGTCTTTAAATTATAACCCTAGG + Intronic
1119571633 14:75679335-75679357 GGACCATAAGCCATAAGCCAAGG + Intronic
1125734234 15:41912347-41912369 GCGCCCTAAACAATAACCCAGGG + Intronic
1127241651 15:57122238-57122260 GGACTTAAAGCTATAACACAAGG - Intronic
1127886759 15:63208207-63208229 GAATCCTAAACTCTAACCCAGGG + Intronic
1130805934 15:87322196-87322218 GGACCAAAATGTATAACCCAAGG + Intergenic
1131319455 15:91372496-91372518 GGACTTTAAACTATACTACAGGG - Intergenic
1131557224 15:93410280-93410302 GGACATTAAAAAATAAGCCAAGG - Intergenic
1133679324 16:8106044-8106066 GGACCCTAGCCTCTAACCCAAGG - Intergenic
1134903514 16:17959779-17959801 GGGCCATAAACTTTAATCCAAGG + Intergenic
1135508523 16:23060243-23060265 GGACCTCAAGCTACATCCCACGG + Intergenic
1136113733 16:28081420-28081442 GGAGCTGAAACCCTAACCCAGGG - Intergenic
1136656798 16:31713882-31713904 GGACCCTAAACCACAAACCACGG - Intronic
1143172313 17:4937474-4937496 TGCCCTGAAACTAAAACCCAGGG + Exonic
1146762501 17:35490665-35490687 GGACCTCAAACTATTAACCGAGG + Intronic
1159224845 18:65520762-65520784 GGCGCTCAAACTAAAACCCAAGG + Intergenic
1161611816 19:5247514-5247536 GGACCTGAGACTGTCACCCAGGG - Intronic
1163474592 19:17517572-17517594 GGACCTTAAACTACCCACCATGG + Intronic
928798444 2:35055663-35055685 TGACTTTAAACTATAATCTAAGG - Intergenic
929304252 2:40342176-40342198 GGGCCATAAACTAAAACCCTTGG - Intronic
935003709 2:99048310-99048332 GGACTTCAAACTATACCACAAGG + Intronic
941142511 2:161802945-161802967 GGACTTTAAAATATAAACCTCGG + Intronic
941743309 2:169059651-169059673 TGACCTCAAACTATACCACAGGG + Intergenic
945461521 2:210115450-210115472 GAAACTCAAACTATAACCCAAGG + Intronic
946955241 2:224922553-224922575 GGACCTGAAACTATAAACACAGG - Intronic
948745838 2:240093238-240093260 AGACCTCAAACTATACCACAAGG - Intergenic
1169929876 20:10821048-10821070 TGACTTTAAACTATAATACAAGG + Intergenic
1170329800 20:15196490-15196512 GGACCATAAACCATAATCCTTGG + Intronic
1175217000 20:57396528-57396550 GGCCCTTCAAAAATAACCCAAGG - Intronic
954056183 3:48027810-48027832 GGGTCTTACACTATCACCCAAGG - Intronic
958210374 3:90467034-90467056 TGACTTCAAACTATAACACAAGG - Intergenic
963859829 3:150297745-150297767 GGTCAGTAAACTATAGCCCATGG - Intergenic
969908496 4:10420661-10420683 GGACTTCAAACTATACCACAAGG - Intergenic
970336498 4:15050850-15050872 GGACCTTAAACTATAACCCATGG + Intronic
974177069 4:58338049-58338071 GGACCTCAAACTATAGTACAAGG + Intergenic
977892488 4:102328114-102328136 GTACATTAAAATTTAACCCATGG - Intronic
978188414 4:105884878-105884900 TGACTTCAAACTATAACACAAGG + Intronic
982468954 4:155762875-155762897 GGTCATCAAACTATAGCCCATGG - Intronic
982826194 4:160006721-160006743 TGACCTCAAACTATACCACAAGG + Intergenic
983915323 4:173285900-173285922 GCACCTTAATCTATTTCCCAGGG + Intronic
987890453 5:23869588-23869610 TGACTTCAAACTATAACACAAGG - Intergenic
989275289 5:39581884-39581906 GGATCTTAAAATCCAACCCAAGG - Intergenic
992293648 5:75305536-75305558 GGCCCTTAAACTATGAACCCAGG + Intergenic
994682761 5:102909681-102909703 GGACTTTAAATTATTACCTATGG - Intronic
999556438 5:152747783-152747805 TGACCTCAAACTATACTCCAGGG + Intergenic
1001937879 5:175718730-175718752 GGACAATAAACTATAACCTTTGG - Intergenic
1006603473 6:35241041-35241063 GTACCTGAAACTCTAACCAAAGG + Intronic
1009283332 6:61779293-61779315 GGGCCATAAAAAATAACCCATGG + Intronic
1009668037 6:66708080-66708102 GGACTTTAAACTATACTACAAGG - Intergenic
1009871200 6:69453740-69453762 TGACTTCAAACTATAACACAAGG - Intergenic
1010768246 6:79800276-79800298 GGGCCTTAATCAATAACCCCAGG + Intergenic
1015780870 6:136864022-136864044 GGACCTGGAACCAGAACCCAAGG - Intronic
1017465846 6:154692874-154692896 GGACCCTAAATTGAAACCCAAGG + Intergenic
1032966783 7:137106908-137106930 TGACCTTAAACTATACTACAAGG + Intergenic
1036638126 8:10565266-10565288 CGAGCTAAAACTAGAACCCAGGG + Intergenic
1040684236 8:49851872-49851894 TGACTTCAAACTATACCCCAAGG + Intergenic
1041182850 8:55266390-55266412 GGACCTTTAAGTCAAACCCATGG - Intronic
1045792322 8:105998008-105998030 GGACCTGAAACTATAGATCAGGG - Intergenic
1047206255 8:122804871-122804893 GGAGCTGAAACTAGAACACAGGG + Intronic
1047415661 8:124662783-124662805 GGACTTTAAAATTTAACCCGTGG - Intronic
1050955399 9:11651586-11651608 GGACCATAAACTATAGGCCATGG + Intergenic
1052559883 9:30071358-30071380 GGACCTAAAACTAAAACTCCCGG + Intergenic
1186122227 X:6375549-6375571 GGGCAGTAAACTATGACCCATGG + Intergenic
1189672815 X:43429213-43429235 TGACTTTAAACTATATCACAAGG - Intergenic
1191989155 X:67014169-67014191 GGAGCTTAAACAATTACCAAAGG + Intergenic
1192475935 X:71443064-71443086 TGACCTCAAACTATAATACAAGG - Intronic
1192524974 X:71834657-71834679 TGACTTTAAACTATACCACAAGG + Intergenic
1194277489 X:91903465-91903487 GAAGCGTAAACTATGACCCAGGG - Intronic
1197076444 X:122359158-122359180 TGACCTTAAACTATACCGCAGGG - Intergenic
1197490170 X:127106630-127106652 TGACTTTAAACTATACCACATGG + Intergenic
1198525602 X:137497330-137497352 GGACCCCAAACTATAAGCAAAGG - Intergenic
1200594833 Y:5125553-5125575 GAAGCGTAAACTATGACCCAGGG - Intronic