ID: 970338136

View in Genome Browser
Species Human (GRCh38)
Location 4:15074508-15074530
Sequence CTGCATATACAGTTAGAAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
970338133_970338136 8 Left 970338133 4:15074477-15074499 CCGATATACTAGAAAGACAGTGA No data
Right 970338136 4:15074508-15074530 CTGCATATACAGTTAGAAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
970338136 Original CRISPR CTGCATATACAGTTAGAAAA AGG Intergenic
No off target data available for this crispr