ID: 970340627

View in Genome Browser
Species Human (GRCh38)
Location 4:15103178-15103200
Sequence GAGATGCTAATGCATGTGGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
970340627_970340630 -5 Left 970340627 4:15103178-15103200 CCAACCACATGCATTAGCATCTC No data
Right 970340630 4:15103196-15103218 ATCTCACTTCAGGAAGCCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
970340627 Original CRISPR GAGATGCTAATGCATGTGGT TGG (reversed) Intergenic
No off target data available for this crispr