ID: 970340737

View in Genome Browser
Species Human (GRCh38)
Location 4:15103912-15103934
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
970340734_970340737 22 Left 970340734 4:15103867-15103889 CCAAAGTCACAGAGGGGAGTTTC No data
Right 970340737 4:15103912-15103934 TTGTTTTTGATTAAGGAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr