ID: 970343061

View in Genome Browser
Species Human (GRCh38)
Location 4:15127062-15127084
Sequence CTGTGCCAGTGCCTTGATCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
970343058_970343061 5 Left 970343058 4:15127034-15127056 CCATCTCTGAACCATGAAGAAGG No data
Right 970343061 4:15127062-15127084 CTGTGCCAGTGCCTTGATCTTGG No data
970343060_970343061 -6 Left 970343060 4:15127045-15127067 CCATGAAGAAGGCACAACTGTGC No data
Right 970343061 4:15127062-15127084 CTGTGCCAGTGCCTTGATCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
970343061 Original CRISPR CTGTGCCAGTGCCTTGATCT TGG Intergenic
No off target data available for this crispr