ID: 970344560

View in Genome Browser
Species Human (GRCh38)
Location 4:15141007-15141029
Sequence GACATGAGCCGTGTGGCTCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
970344560_970344564 15 Left 970344560 4:15141007-15141029 CCCAGAGCCACACGGCTCATGTC No data
Right 970344564 4:15141045-15141067 TTGTTGATTCCTTACTTCTGTGG No data
970344560_970344565 16 Left 970344560 4:15141007-15141029 CCCAGAGCCACACGGCTCATGTC No data
Right 970344565 4:15141046-15141068 TGTTGATTCCTTACTTCTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
970344560 Original CRISPR GACATGAGCCGTGTGGCTCT GGG (reversed) Intergenic
No off target data available for this crispr