ID: 970344565

View in Genome Browser
Species Human (GRCh38)
Location 4:15141046-15141068
Sequence TGTTGATTCCTTACTTCTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
970344556_970344565 24 Left 970344556 4:15140999-15141021 CCAAGGCCCCCAGAGCCACACGG No data
Right 970344565 4:15141046-15141068 TGTTGATTCCTTACTTCTGTGGG No data
970344558_970344565 18 Left 970344558 4:15141005-15141027 CCCCCAGAGCCACACGGCTCATG No data
Right 970344565 4:15141046-15141068 TGTTGATTCCTTACTTCTGTGGG No data
970344560_970344565 16 Left 970344560 4:15141007-15141029 CCCAGAGCCACACGGCTCATGTC No data
Right 970344565 4:15141046-15141068 TGTTGATTCCTTACTTCTGTGGG No data
970344561_970344565 15 Left 970344561 4:15141008-15141030 CCAGAGCCACACGGCTCATGTCT No data
Right 970344565 4:15141046-15141068 TGTTGATTCCTTACTTCTGTGGG No data
970344559_970344565 17 Left 970344559 4:15141006-15141028 CCCCAGAGCCACACGGCTCATGT No data
Right 970344565 4:15141046-15141068 TGTTGATTCCTTACTTCTGTGGG No data
970344563_970344565 -10 Left 970344563 4:15141033-15141055 CCTGAATCTTAGTTGTTGATTCC No data
Right 970344565 4:15141046-15141068 TGTTGATTCCTTACTTCTGTGGG No data
970344562_970344565 9 Left 970344562 4:15141014-15141036 CCACACGGCTCATGTCTTTCCTG No data
Right 970344565 4:15141046-15141068 TGTTGATTCCTTACTTCTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
970344565 Original CRISPR TGTTGATTCCTTACTTCTGT GGG Intergenic
No off target data available for this crispr