ID: 970347005

View in Genome Browser
Species Human (GRCh38)
Location 4:15162134-15162156
Sequence AAGAATAAGCAGGAGGAGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
970347005_970347010 15 Left 970347005 4:15162134-15162156 CCCACCTCCTCCTGCTTATTCTT No data
Right 970347010 4:15162172-15162194 TTCCCCAACACACTCACAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
970347005 Original CRISPR AAGAATAAGCAGGAGGAGGT GGG (reversed) Intergenic
No off target data available for this crispr