ID: 970349118

View in Genome Browser
Species Human (GRCh38)
Location 4:15183384-15183406
Sequence TTCCCAGGCCACTCACATGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
970349110_970349118 -6 Left 970349110 4:15183367-15183389 CCTTTTCCTTCCTCCATTTCCCA No data
Right 970349118 4:15183384-15183406 TTCCCAGGCCACTCACATGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
970349118 Original CRISPR TTCCCAGGCCACTCACATGG GGG Intergenic
No off target data available for this crispr