ID: 970353230

View in Genome Browser
Species Human (GRCh38)
Location 4:15227244-15227266
Sequence GCTTAATGGGGATGAGGGTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
970353230_970353242 24 Left 970353230 4:15227244-15227266 CCTAACCCTCATCCCCATTAAGC No data
Right 970353242 4:15227291-15227313 GTGTGGGTAGATATTTTTGGTGG No data
970353230_970353241 21 Left 970353230 4:15227244-15227266 CCTAACCCTCATCCCCATTAAGC No data
Right 970353241 4:15227288-15227310 CTTGTGTGGGTAGATATTTTTGG No data
970353230_970353240 8 Left 970353230 4:15227244-15227266 CCTAACCCTCATCCCCATTAAGC No data
Right 970353240 4:15227275-15227297 CACTCACGTGGGTCTTGTGTGGG No data
970353230_970353236 -4 Left 970353230 4:15227244-15227266 CCTAACCCTCATCCCCATTAAGC No data
Right 970353236 4:15227263-15227285 AAGCCAAACAAGCACTCACGTGG No data
970353230_970353239 7 Left 970353230 4:15227244-15227266 CCTAACCCTCATCCCCATTAAGC No data
Right 970353239 4:15227274-15227296 GCACTCACGTGGGTCTTGTGTGG No data
970353230_970353237 -3 Left 970353230 4:15227244-15227266 CCTAACCCTCATCCCCATTAAGC No data
Right 970353237 4:15227264-15227286 AGCCAAACAAGCACTCACGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
970353230 Original CRISPR GCTTAATGGGGATGAGGGTT AGG (reversed) Intergenic
No off target data available for this crispr