ID: 970353233

View in Genome Browser
Species Human (GRCh38)
Location 4:15227256-15227278
Sequence AGTGCTTGTTTGGCTTAATG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
970353233_970353240 -4 Left 970353233 4:15227256-15227278 CCCCATTAAGCCAAACAAGCACT No data
Right 970353240 4:15227275-15227297 CACTCACGTGGGTCTTGTGTGGG No data
970353233_970353239 -5 Left 970353233 4:15227256-15227278 CCCCATTAAGCCAAACAAGCACT No data
Right 970353239 4:15227274-15227296 GCACTCACGTGGGTCTTGTGTGG No data
970353233_970353243 25 Left 970353233 4:15227256-15227278 CCCCATTAAGCCAAACAAGCACT No data
Right 970353243 4:15227304-15227326 TTTTTGGTGGAAATCAGTGAAGG No data
970353233_970353242 12 Left 970353233 4:15227256-15227278 CCCCATTAAGCCAAACAAGCACT No data
Right 970353242 4:15227291-15227313 GTGTGGGTAGATATTTTTGGTGG No data
970353233_970353241 9 Left 970353233 4:15227256-15227278 CCCCATTAAGCCAAACAAGCACT No data
Right 970353241 4:15227288-15227310 CTTGTGTGGGTAGATATTTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
970353233 Original CRISPR AGTGCTTGTTTGGCTTAATG GGG (reversed) Intergenic
No off target data available for this crispr