ID: 970353235

View in Genome Browser
Species Human (GRCh38)
Location 4:15227258-15227280
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
970353235_970353240 -6 Left 970353235 4:15227258-15227280 CCATTAAGCCAAACAAGCACTCA No data
Right 970353240 4:15227275-15227297 CACTCACGTGGGTCTTGTGTGGG No data
970353235_970353239 -7 Left 970353235 4:15227258-15227280 CCATTAAGCCAAACAAGCACTCA No data
Right 970353239 4:15227274-15227296 GCACTCACGTGGGTCTTGTGTGG No data
970353235_970353243 23 Left 970353235 4:15227258-15227280 CCATTAAGCCAAACAAGCACTCA No data
Right 970353243 4:15227304-15227326 TTTTTGGTGGAAATCAGTGAAGG No data
970353235_970353241 7 Left 970353235 4:15227258-15227280 CCATTAAGCCAAACAAGCACTCA No data
Right 970353241 4:15227288-15227310 CTTGTGTGGGTAGATATTTTTGG No data
970353235_970353244 29 Left 970353235 4:15227258-15227280 CCATTAAGCCAAACAAGCACTCA No data
Right 970353244 4:15227310-15227332 GTGGAAATCAGTGAAGGAAGAGG No data
970353235_970353242 10 Left 970353235 4:15227258-15227280 CCATTAAGCCAAACAAGCACTCA No data
Right 970353242 4:15227291-15227313 GTGTGGGTAGATATTTTTGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
970353235 Original CRISPR TGAGTGCTTGTTTGGCTTAA TGG (reversed) Intergenic
No off target data available for this crispr