ID: 970353240

View in Genome Browser
Species Human (GRCh38)
Location 4:15227275-15227297
Sequence CACTCACGTGGGTCTTGTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
970353234_970353240 -5 Left 970353234 4:15227257-15227279 CCCATTAAGCCAAACAAGCACTC No data
Right 970353240 4:15227275-15227297 CACTCACGTGGGTCTTGTGTGGG No data
970353232_970353240 2 Left 970353232 4:15227250-15227272 CCTCATCCCCATTAAGCCAAACA No data
Right 970353240 4:15227275-15227297 CACTCACGTGGGTCTTGTGTGGG No data
970353235_970353240 -6 Left 970353235 4:15227258-15227280 CCATTAAGCCAAACAAGCACTCA No data
Right 970353240 4:15227275-15227297 CACTCACGTGGGTCTTGTGTGGG No data
970353233_970353240 -4 Left 970353233 4:15227256-15227278 CCCCATTAAGCCAAACAAGCACT No data
Right 970353240 4:15227275-15227297 CACTCACGTGGGTCTTGTGTGGG No data
970353231_970353240 3 Left 970353231 4:15227249-15227271 CCCTCATCCCCATTAAGCCAAAC No data
Right 970353240 4:15227275-15227297 CACTCACGTGGGTCTTGTGTGGG No data
970353230_970353240 8 Left 970353230 4:15227244-15227266 CCTAACCCTCATCCCCATTAAGC No data
Right 970353240 4:15227275-15227297 CACTCACGTGGGTCTTGTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
970353240 Original CRISPR CACTCACGTGGGTCTTGTGT GGG Intergenic
No off target data available for this crispr