ID: 970355209

View in Genome Browser
Species Human (GRCh38)
Location 4:15244731-15244753
Sequence TTTGGACAGGATGATTACCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
970355209_970355219 24 Left 970355209 4:15244731-15244753 CCCAGGTAATCATCCTGTCCAAA No data
Right 970355219 4:15244778-15244800 TCAGTCAATGTGTCTGGTCAAGG No data
970355209_970355220 25 Left 970355209 4:15244731-15244753 CCCAGGTAATCATCCTGTCCAAA No data
Right 970355220 4:15244779-15244801 CAGTCAATGTGTCTGGTCAAGGG No data
970355209_970355218 18 Left 970355209 4:15244731-15244753 CCCAGGTAATCATCCTGTCCAAA No data
Right 970355218 4:15244772-15244794 CACATTTCAGTCAATGTGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
970355209 Original CRISPR TTTGGACAGGATGATTACCT GGG (reversed) Intergenic