ID: 970355210

View in Genome Browser
Species Human (GRCh38)
Location 4:15244732-15244754
Sequence TTTTGGACAGGATGATTACC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
970355210_970355219 23 Left 970355210 4:15244732-15244754 CCAGGTAATCATCCTGTCCAAAA No data
Right 970355219 4:15244778-15244800 TCAGTCAATGTGTCTGGTCAAGG No data
970355210_970355218 17 Left 970355210 4:15244732-15244754 CCAGGTAATCATCCTGTCCAAAA No data
Right 970355218 4:15244772-15244794 CACATTTCAGTCAATGTGTCTGG No data
970355210_970355220 24 Left 970355210 4:15244732-15244754 CCAGGTAATCATCCTGTCCAAAA No data
Right 970355220 4:15244779-15244801 CAGTCAATGTGTCTGGTCAAGGG No data
970355210_970355221 30 Left 970355210 4:15244732-15244754 CCAGGTAATCATCCTGTCCAAAA No data
Right 970355221 4:15244785-15244807 ATGTGTCTGGTCAAGGGATAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
970355210 Original CRISPR TTTTGGACAGGATGATTACC TGG (reversed) Intergenic