ID: 970355213

View in Genome Browser
Species Human (GRCh38)
Location 4:15244744-15244766
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
970355213_970355218 5 Left 970355213 4:15244744-15244766 CCTGTCCAAAAGCCTATTGGGTC No data
Right 970355218 4:15244772-15244794 CACATTTCAGTCAATGTGTCTGG No data
970355213_970355222 24 Left 970355213 4:15244744-15244766 CCTGTCCAAAAGCCTATTGGGTC No data
Right 970355222 4:15244791-15244813 CTGGTCAAGGGATAAGGTCAAGG No data
970355213_970355223 28 Left 970355213 4:15244744-15244766 CCTGTCCAAAAGCCTATTGGGTC No data
Right 970355223 4:15244795-15244817 TCAAGGGATAAGGTCAAGGTTGG No data
970355213_970355221 18 Left 970355213 4:15244744-15244766 CCTGTCCAAAAGCCTATTGGGTC No data
Right 970355221 4:15244785-15244807 ATGTGTCTGGTCAAGGGATAAGG No data
970355213_970355219 11 Left 970355213 4:15244744-15244766 CCTGTCCAAAAGCCTATTGGGTC No data
Right 970355219 4:15244778-15244800 TCAGTCAATGTGTCTGGTCAAGG No data
970355213_970355220 12 Left 970355213 4:15244744-15244766 CCTGTCCAAAAGCCTATTGGGTC No data
Right 970355220 4:15244779-15244801 CAGTCAATGTGTCTGGTCAAGGG 0: 1
1: 0
2: 1
3: 12
4: 187

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
970355213 Original CRISPR GACCCAATAGGCTTTTGGAC AGG (reversed) Intergenic