ID: 970355214

View in Genome Browser
Species Human (GRCh38)
Location 4:15244749-15244771
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
970355214_970355223 23 Left 970355214 4:15244749-15244771 CCAAAAGCCTATTGGGTCCTTGC No data
Right 970355223 4:15244795-15244817 TCAAGGGATAAGGTCAAGGTTGG No data
970355214_970355225 28 Left 970355214 4:15244749-15244771 CCAAAAGCCTATTGGGTCCTTGC No data
Right 970355225 4:15244800-15244822 GGATAAGGTCAAGGTTGGCAGGG 0: 1
1: 0
2: 2
3: 18
4: 182
970355214_970355222 19 Left 970355214 4:15244749-15244771 CCAAAAGCCTATTGGGTCCTTGC No data
Right 970355222 4:15244791-15244813 CTGGTCAAGGGATAAGGTCAAGG No data
970355214_970355220 7 Left 970355214 4:15244749-15244771 CCAAAAGCCTATTGGGTCCTTGC No data
Right 970355220 4:15244779-15244801 CAGTCAATGTGTCTGGTCAAGGG No data
970355214_970355221 13 Left 970355214 4:15244749-15244771 CCAAAAGCCTATTGGGTCCTTGC No data
Right 970355221 4:15244785-15244807 ATGTGTCTGGTCAAGGGATAAGG No data
970355214_970355224 27 Left 970355214 4:15244749-15244771 CCAAAAGCCTATTGGGTCCTTGC No data
Right 970355224 4:15244799-15244821 GGGATAAGGTCAAGGTTGGCAGG 0: 1
1: 0
2: 1
3: 6
4: 133
970355214_970355219 6 Left 970355214 4:15244749-15244771 CCAAAAGCCTATTGGGTCCTTGC No data
Right 970355219 4:15244778-15244800 TCAGTCAATGTGTCTGGTCAAGG No data
970355214_970355218 0 Left 970355214 4:15244749-15244771 CCAAAAGCCTATTGGGTCCTTGC No data
Right 970355218 4:15244772-15244794 CACATTTCAGTCAATGTGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
970355214 Original CRISPR GCAAGGACCCAATAGGCTTT TGG (reversed) Intergenic