ID: 970355215

View in Genome Browser
Species Human (GRCh38)
Location 4:15244756-15244778
Sequence AAATGTGGCAAGGACCCAAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
970355215_970355221 6 Left 970355215 4:15244756-15244778 CCTATTGGGTCCTTGCCACATTT No data
Right 970355221 4:15244785-15244807 ATGTGTCTGGTCAAGGGATAAGG No data
970355215_970355223 16 Left 970355215 4:15244756-15244778 CCTATTGGGTCCTTGCCACATTT No data
Right 970355223 4:15244795-15244817 TCAAGGGATAAGGTCAAGGTTGG No data
970355215_970355219 -1 Left 970355215 4:15244756-15244778 CCTATTGGGTCCTTGCCACATTT No data
Right 970355219 4:15244778-15244800 TCAGTCAATGTGTCTGGTCAAGG No data
970355215_970355222 12 Left 970355215 4:15244756-15244778 CCTATTGGGTCCTTGCCACATTT No data
Right 970355222 4:15244791-15244813 CTGGTCAAGGGATAAGGTCAAGG No data
970355215_970355225 21 Left 970355215 4:15244756-15244778 CCTATTGGGTCCTTGCCACATTT No data
Right 970355225 4:15244800-15244822 GGATAAGGTCAAGGTTGGCAGGG No data
970355215_970355218 -7 Left 970355215 4:15244756-15244778 CCTATTGGGTCCTTGCCACATTT No data
Right 970355218 4:15244772-15244794 CACATTTCAGTCAATGTGTCTGG No data
970355215_970355220 0 Left 970355215 4:15244756-15244778 CCTATTGGGTCCTTGCCACATTT No data
Right 970355220 4:15244779-15244801 CAGTCAATGTGTCTGGTCAAGGG No data
970355215_970355224 20 Left 970355215 4:15244756-15244778 CCTATTGGGTCCTTGCCACATTT No data
Right 970355224 4:15244799-15244821 GGGATAAGGTCAAGGTTGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
970355215 Original CRISPR AAATGTGGCAAGGACCCAAT AGG (reversed) Intergenic