ID: 970355216

View in Genome Browser
Species Human (GRCh38)
Location 4:15244766-15244788
Sequence ACATTGACTGAAATGTGGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
970355216_970355224 10 Left 970355216 4:15244766-15244788 CCTTGCCACATTTCAGTCAATGT No data
Right 970355224 4:15244799-15244821 GGGATAAGGTCAAGGTTGGCAGG No data
970355216_970355222 2 Left 970355216 4:15244766-15244788 CCTTGCCACATTTCAGTCAATGT No data
Right 970355222 4:15244791-15244813 CTGGTCAAGGGATAAGGTCAAGG No data
970355216_970355221 -4 Left 970355216 4:15244766-15244788 CCTTGCCACATTTCAGTCAATGT No data
Right 970355221 4:15244785-15244807 ATGTGTCTGGTCAAGGGATAAGG No data
970355216_970355225 11 Left 970355216 4:15244766-15244788 CCTTGCCACATTTCAGTCAATGT No data
Right 970355225 4:15244800-15244822 GGATAAGGTCAAGGTTGGCAGGG No data
970355216_970355223 6 Left 970355216 4:15244766-15244788 CCTTGCCACATTTCAGTCAATGT No data
Right 970355223 4:15244795-15244817 TCAAGGGATAAGGTCAAGGTTGG No data
970355216_970355220 -10 Left 970355216 4:15244766-15244788 CCTTGCCACATTTCAGTCAATGT No data
Right 970355220 4:15244779-15244801 CAGTCAATGTGTCTGGTCAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
970355216 Original CRISPR ACATTGACTGAAATGTGGCA AGG (reversed) Intergenic