ID: 970355217

View in Genome Browser
Species Human (GRCh38)
Location 4:15244771-15244793
Sequence CAGACACATTGACTGAAATG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
970355217_970355222 -3 Left 970355217 4:15244771-15244793 CCACATTTCAGTCAATGTGTCTG No data
Right 970355222 4:15244791-15244813 CTGGTCAAGGGATAAGGTCAAGG No data
970355217_970355223 1 Left 970355217 4:15244771-15244793 CCACATTTCAGTCAATGTGTCTG No data
Right 970355223 4:15244795-15244817 TCAAGGGATAAGGTCAAGGTTGG No data
970355217_970355221 -9 Left 970355217 4:15244771-15244793 CCACATTTCAGTCAATGTGTCTG No data
Right 970355221 4:15244785-15244807 ATGTGTCTGGTCAAGGGATAAGG No data
970355217_970355225 6 Left 970355217 4:15244771-15244793 CCACATTTCAGTCAATGTGTCTG No data
Right 970355225 4:15244800-15244822 GGATAAGGTCAAGGTTGGCAGGG 0: 1
1: 0
2: 2
3: 18
4: 182
970355217_970355224 5 Left 970355217 4:15244771-15244793 CCACATTTCAGTCAATGTGTCTG No data
Right 970355224 4:15244799-15244821 GGGATAAGGTCAAGGTTGGCAGG 0: 1
1: 0
2: 1
3: 6
4: 133

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
970355217 Original CRISPR CAGACACATTGACTGAAATG TGG (reversed) Intergenic