ID: 970355218

View in Genome Browser
Species Human (GRCh38)
Location 4:15244772-15244794
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
970355207_970355218 26 Left 970355207 4:15244723-15244745 CCAGAATCCCCAGGTAATCATCC No data
Right 970355218 4:15244772-15244794 CACATTTCAGTCAATGTGTCTGG No data
970355214_970355218 0 Left 970355214 4:15244749-15244771 CCAAAAGCCTATTGGGTCCTTGC No data
Right 970355218 4:15244772-15244794 CACATTTCAGTCAATGTGTCTGG No data
970355215_970355218 -7 Left 970355215 4:15244756-15244778 CCTATTGGGTCCTTGCCACATTT No data
Right 970355218 4:15244772-15244794 CACATTTCAGTCAATGTGTCTGG No data
970355208_970355218 19 Left 970355208 4:15244730-15244752 CCCCAGGTAATCATCCTGTCCAA No data
Right 970355218 4:15244772-15244794 CACATTTCAGTCAATGTGTCTGG No data
970355210_970355218 17 Left 970355210 4:15244732-15244754 CCAGGTAATCATCCTGTCCAAAA No data
Right 970355218 4:15244772-15244794 CACATTTCAGTCAATGTGTCTGG No data
970355213_970355218 5 Left 970355213 4:15244744-15244766 CCTGTCCAAAAGCCTATTGGGTC No data
Right 970355218 4:15244772-15244794 CACATTTCAGTCAATGTGTCTGG No data
970355209_970355218 18 Left 970355209 4:15244731-15244753 CCCAGGTAATCATCCTGTCCAAA No data
Right 970355218 4:15244772-15244794 CACATTTCAGTCAATGTGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type