ID: 970355220

View in Genome Browser
Species Human (GRCh38)
Location 4:15244779-15244801
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 201
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 187}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
970355213_970355220 12 Left 970355213 4:15244744-15244766 CCTGTCCAAAAGCCTATTGGGTC No data
Right 970355220 4:15244779-15244801 CAGTCAATGTGTCTGGTCAAGGG 0: 1
1: 0
2: 1
3: 12
4: 187
970355216_970355220 -10 Left 970355216 4:15244766-15244788 CCTTGCCACATTTCAGTCAATGT No data
Right 970355220 4:15244779-15244801 CAGTCAATGTGTCTGGTCAAGGG 0: 1
1: 0
2: 1
3: 12
4: 187
970355209_970355220 25 Left 970355209 4:15244731-15244753 CCCAGGTAATCATCCTGTCCAAA No data
Right 970355220 4:15244779-15244801 CAGTCAATGTGTCTGGTCAAGGG 0: 1
1: 0
2: 1
3: 12
4: 187
970355208_970355220 26 Left 970355208 4:15244730-15244752 CCCCAGGTAATCATCCTGTCCAA No data
Right 970355220 4:15244779-15244801 CAGTCAATGTGTCTGGTCAAGGG 0: 1
1: 0
2: 1
3: 12
4: 187
970355215_970355220 0 Left 970355215 4:15244756-15244778 CCTATTGGGTCCTTGCCACATTT No data
Right 970355220 4:15244779-15244801 CAGTCAATGTGTCTGGTCAAGGG 0: 1
1: 0
2: 1
3: 12
4: 187
970355214_970355220 7 Left 970355214 4:15244749-15244771 CCAAAAGCCTATTGGGTCCTTGC No data
Right 970355220 4:15244779-15244801 CAGTCAATGTGTCTGGTCAAGGG 0: 1
1: 0
2: 1
3: 12
4: 187
970355210_970355220 24 Left 970355210 4:15244732-15244754 CCAGGTAATCATCCTGTCCAAAA No data
Right 970355220 4:15244779-15244801 CAGTCAATGTGTCTGGTCAAGGG 0: 1
1: 0
2: 1
3: 12
4: 187

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type