ID: 970355221

View in Genome Browser
Species Human (GRCh38)
Location 4:15244785-15244807
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
970355210_970355221 30 Left 970355210 4:15244732-15244754 CCAGGTAATCATCCTGTCCAAAA No data
Right 970355221 4:15244785-15244807 ATGTGTCTGGTCAAGGGATAAGG No data
970355217_970355221 -9 Left 970355217 4:15244771-15244793 CCACATTTCAGTCAATGTGTCTG No data
Right 970355221 4:15244785-15244807 ATGTGTCTGGTCAAGGGATAAGG No data
970355215_970355221 6 Left 970355215 4:15244756-15244778 CCTATTGGGTCCTTGCCACATTT No data
Right 970355221 4:15244785-15244807 ATGTGTCTGGTCAAGGGATAAGG No data
970355214_970355221 13 Left 970355214 4:15244749-15244771 CCAAAAGCCTATTGGGTCCTTGC No data
Right 970355221 4:15244785-15244807 ATGTGTCTGGTCAAGGGATAAGG No data
970355216_970355221 -4 Left 970355216 4:15244766-15244788 CCTTGCCACATTTCAGTCAATGT No data
Right 970355221 4:15244785-15244807 ATGTGTCTGGTCAAGGGATAAGG No data
970355213_970355221 18 Left 970355213 4:15244744-15244766 CCTGTCCAAAAGCCTATTGGGTC No data
Right 970355221 4:15244785-15244807 ATGTGTCTGGTCAAGGGATAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr