ID: 970355222

View in Genome Browser
Species Human (GRCh38)
Location 4:15244791-15244813
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
970355214_970355222 19 Left 970355214 4:15244749-15244771 CCAAAAGCCTATTGGGTCCTTGC No data
Right 970355222 4:15244791-15244813 CTGGTCAAGGGATAAGGTCAAGG No data
970355213_970355222 24 Left 970355213 4:15244744-15244766 CCTGTCCAAAAGCCTATTGGGTC No data
Right 970355222 4:15244791-15244813 CTGGTCAAGGGATAAGGTCAAGG No data
970355216_970355222 2 Left 970355216 4:15244766-15244788 CCTTGCCACATTTCAGTCAATGT No data
Right 970355222 4:15244791-15244813 CTGGTCAAGGGATAAGGTCAAGG No data
970355217_970355222 -3 Left 970355217 4:15244771-15244793 CCACATTTCAGTCAATGTGTCTG No data
Right 970355222 4:15244791-15244813 CTGGTCAAGGGATAAGGTCAAGG No data
970355215_970355222 12 Left 970355215 4:15244756-15244778 CCTATTGGGTCCTTGCCACATTT No data
Right 970355222 4:15244791-15244813 CTGGTCAAGGGATAAGGTCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type