ID: 970355224

View in Genome Browser
Species Human (GRCh38)
Location 4:15244799-15244821
Sequence GGGATAAGGTCAAGGTTGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
970355217_970355224 5 Left 970355217 4:15244771-15244793 CCACATTTCAGTCAATGTGTCTG No data
Right 970355224 4:15244799-15244821 GGGATAAGGTCAAGGTTGGCAGG No data
970355214_970355224 27 Left 970355214 4:15244749-15244771 CCAAAAGCCTATTGGGTCCTTGC No data
Right 970355224 4:15244799-15244821 GGGATAAGGTCAAGGTTGGCAGG No data
970355216_970355224 10 Left 970355216 4:15244766-15244788 CCTTGCCACATTTCAGTCAATGT No data
Right 970355224 4:15244799-15244821 GGGATAAGGTCAAGGTTGGCAGG No data
970355215_970355224 20 Left 970355215 4:15244756-15244778 CCTATTGGGTCCTTGCCACATTT No data
Right 970355224 4:15244799-15244821 GGGATAAGGTCAAGGTTGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
970355224 Original CRISPR GGGATAAGGTCAAGGTTGGC AGG Intergenic