ID: 970355225

View in Genome Browser
Species Human (GRCh38)
Location 4:15244800-15244822
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 203
Summary {0: 1, 1: 0, 2: 2, 3: 18, 4: 182}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
970355215_970355225 21 Left 970355215 4:15244756-15244778 CCTATTGGGTCCTTGCCACATTT No data
Right 970355225 4:15244800-15244822 GGATAAGGTCAAGGTTGGCAGGG 0: 1
1: 0
2: 2
3: 18
4: 182
970355216_970355225 11 Left 970355216 4:15244766-15244788 CCTTGCCACATTTCAGTCAATGT No data
Right 970355225 4:15244800-15244822 GGATAAGGTCAAGGTTGGCAGGG 0: 1
1: 0
2: 2
3: 18
4: 182
970355214_970355225 28 Left 970355214 4:15244749-15244771 CCAAAAGCCTATTGGGTCCTTGC No data
Right 970355225 4:15244800-15244822 GGATAAGGTCAAGGTTGGCAGGG 0: 1
1: 0
2: 2
3: 18
4: 182
970355217_970355225 6 Left 970355217 4:15244771-15244793 CCACATTTCAGTCAATGTGTCTG No data
Right 970355225 4:15244800-15244822 GGATAAGGTCAAGGTTGGCAGGG 0: 1
1: 0
2: 2
3: 18
4: 182

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type