ID: 970359317

View in Genome Browser
Species Human (GRCh38)
Location 4:15292509-15292531
Sequence TCTGGAAACAAATGCACAGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
970359317_970359325 13 Left 970359317 4:15292509-15292531 CCCCCTGTGCATTTGTTTCCAGA No data
Right 970359325 4:15292545-15292567 ACAGTTCATTATCTGTGTATGGG No data
970359317_970359326 14 Left 970359317 4:15292509-15292531 CCCCCTGTGCATTTGTTTCCAGA No data
Right 970359326 4:15292546-15292568 CAGTTCATTATCTGTGTATGGGG No data
970359317_970359324 12 Left 970359317 4:15292509-15292531 CCCCCTGTGCATTTGTTTCCAGA No data
Right 970359324 4:15292544-15292566 AACAGTTCATTATCTGTGTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
970359317 Original CRISPR TCTGGAAACAAATGCACAGG GGG (reversed) Intergenic
No off target data available for this crispr