ID: 970359325

View in Genome Browser
Species Human (GRCh38)
Location 4:15292545-15292567
Sequence ACAGTTCATTATCTGTGTAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
970359317_970359325 13 Left 970359317 4:15292509-15292531 CCCCCTGTGCATTTGTTTCCAGA No data
Right 970359325 4:15292545-15292567 ACAGTTCATTATCTGTGTATGGG No data
970359318_970359325 12 Left 970359318 4:15292510-15292532 CCCCTGTGCATTTGTTTCCAGAT No data
Right 970359325 4:15292545-15292567 ACAGTTCATTATCTGTGTATGGG No data
970359316_970359325 24 Left 970359316 4:15292498-15292520 CCTGAGGCTTTCCCCCTGTGCAT No data
Right 970359325 4:15292545-15292567 ACAGTTCATTATCTGTGTATGGG No data
970359319_970359325 11 Left 970359319 4:15292511-15292533 CCCTGTGCATTTGTTTCCAGATC No data
Right 970359325 4:15292545-15292567 ACAGTTCATTATCTGTGTATGGG No data
970359321_970359325 -5 Left 970359321 4:15292527-15292549 CCAGATCCCATTTTAGTAACAGT No data
Right 970359325 4:15292545-15292567 ACAGTTCATTATCTGTGTATGGG No data
970359320_970359325 10 Left 970359320 4:15292512-15292534 CCTGTGCATTTGTTTCCAGATCC No data
Right 970359325 4:15292545-15292567 ACAGTTCATTATCTGTGTATGGG No data
970359315_970359325 25 Left 970359315 4:15292497-15292519 CCCTGAGGCTTTCCCCCTGTGCA No data
Right 970359325 4:15292545-15292567 ACAGTTCATTATCTGTGTATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
970359325 Original CRISPR ACAGTTCATTATCTGTGTAT GGG Intergenic
No off target data available for this crispr