ID: 970374477

View in Genome Browser
Species Human (GRCh38)
Location 4:15442709-15442731
Sequence ATAAGCTGTCTGCCCAACCT GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 109
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 101}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
970374477 Original CRISPR ATAAGCTGTCTGCCCAACCT GGG (reversed) Exonic
904042750 1:27593731-27593753 CCCAGCTGTCTGCCCACCCTGGG - Intronic
906303525 1:44701269-44701291 ATGAACTCTCTGCCCTACCTTGG - Intronic
913611451 1:120513424-120513446 ATTAGCTGTCAACCCAACTTTGG + Intergenic
914398173 1:147290474-147290496 ATCAACTGCCTGCCCAACCTCGG - Intronic
914579741 1:149008815-149008837 ATTAGCTGTCAACCCAACTTTGG - Intronic
915170641 1:153974862-153974884 AGAAGCTGTCTGGCCTTCCTTGG - Intronic
916508393 1:165448814-165448836 AAAAGATGTCTCCCTAACCTAGG + Intergenic
917235414 1:172886693-172886715 TAAAGCTGTCTGTCTAACCTAGG + Intergenic
920167606 1:204046656-204046678 ATAAGCTGTCTGCGCTTCCCTGG - Intergenic
1064535036 10:16349789-16349811 ATTGGAAGTCTGCCCAACCTGGG + Intergenic
1065187906 10:23187278-23187300 AAAAGCAATCTGCCCAAGCTGGG + Intergenic
1069375292 10:67787078-67787100 AAAATCTGTCTCTCCAACCTGGG - Intergenic
1080395380 11:31885435-31885457 CTCAGCTGTCTCCCCAACTTTGG + Intronic
1081362911 11:42202125-42202147 ATAAGCTGTGTACCAAACGTAGG + Intergenic
1083343348 11:61973172-61973194 TTAAGCTGTGTCCCCAACCCTGG + Intergenic
1083488501 11:62998320-62998342 ATGAGCTCTCTGCCCACTCTGGG + Intronic
1084870411 11:72095021-72095043 ATAAGCTGGCTGTCCTTCCTCGG + Exonic
1088218632 11:107542673-107542695 TCAAGCAGTCTGCCCTACCTTGG - Intronic
1089617979 11:119705921-119705943 ACAAGCTGTCTTCCCATCCTGGG + Intronic
1097834858 12:64262897-64262919 AAAAGCTTTCTGTCCACCCTTGG + Intergenic
1098519147 12:71416311-71416333 ATAAGCTGTTTTATCAACCTGGG - Intronic
1101373241 12:104149248-104149270 AGCAGCTGCCTGTCCAACCTTGG + Intergenic
1103026099 12:117575316-117575338 AGAAGCTGCCTCCCCATCCTTGG + Intronic
1106139787 13:27002542-27002564 CCAAGCTGTTTCCCCAACCTTGG + Intergenic
1114075455 14:19159033-19159055 ATAGGCTTTCTGCCCACCATGGG - Intergenic
1114086813 14:19240947-19240969 ATAGGCTTTCTGCCCACCATGGG + Intergenic
1117654888 14:57944955-57944977 AGCATCTGCCTGCCCAACCTTGG + Intronic
1121233609 14:92376631-92376653 AAAACCTGTCTGCCCCAGCTGGG - Intronic
1121896932 14:97657454-97657476 AGAAGGGGTCTGCACAACCTTGG + Intergenic
1122794051 14:104196922-104196944 AGGCGATGTCTGCCCAACCTTGG - Intergenic
1123919179 15:25058509-25058531 ACAGGCAGTCTGCCCAACCTAGG - Intergenic
1125851113 15:42903662-42903684 AGAAGCAGTCAGCCAAACCTGGG - Intronic
1128777198 15:70329513-70329535 ATAAGTTGTCTGGCCAACTTGGG - Intergenic
1135807364 16:25555081-25555103 ATAATTTGTCTGCCCAAGCAAGG + Intergenic
1136707480 16:32201769-32201791 ATGAGCTGCCAGCCCAACCCAGG - Intergenic
1136760431 16:32727648-32727670 ATGAGCTGCCAGCCCAACCCAGG + Intergenic
1136807672 16:33142738-33142760 ATGAGCTGCCAGCCCAACCCAGG - Intergenic
1140195305 16:72850157-72850179 ATCAGCCCTCTGCCCACCCTGGG + Intronic
1141672145 16:85497776-85497798 AAAAGCAGTCTGCCCCACCCCGG - Intergenic
1203062584 16_KI270728v1_random:987963-987985 ATGAGCTGCCAGCCCAACCCAGG + Intergenic
1143036182 17:4000451-4000473 ATAAGCTGCCTGCCACATCTGGG + Intergenic
1148667183 17:49383460-49383482 AGAAGCAGTCTGCCCACCCCTGG + Intronic
1150965291 17:69960910-69960932 ATAAGCTGGCTGCCCTTCCAAGG - Intergenic
1151155440 17:72120922-72120944 ATCAGCTGCCTGCCAACCCTGGG + Intergenic
1155173014 18:23280962-23280984 AAAAGCTGCCTTCCCTACCTGGG - Intronic
1156417597 18:36913582-36913604 AGCAACTGCCTGCCCAACCTTGG + Intronic
1157587902 18:48816990-48817012 GGAAGCTGTGTCCCCAACCTGGG + Intronic
1159035367 18:63272180-63272202 ATATGCTGTCTCCCCAGCCTGGG - Intronic
1161769907 19:6225477-6225499 ATGAGCTGTCGGCCCCACCATGG - Intronic
927701192 2:25270006-25270028 CTAGGCTGTGTGCCCCACCTGGG - Intronic
929370081 2:41212508-41212530 AAAAGCTGGATGCCAAACCTGGG - Intergenic
929812916 2:45206749-45206771 CTAATCCATCTGCCCAACCTAGG + Intergenic
930852663 2:55977184-55977206 AGCAGCTGCCTGTCCAACCTTGG + Intergenic
938186095 2:129233320-129233342 AGAAGCTGCCAGCCCAGCCTTGG + Intergenic
940100325 2:150030168-150030190 ATCAGCTTTTTGCCCAATCTGGG - Intergenic
947549598 2:231037202-231037224 ATTGTCTGTCTTCCCAACCTCGG + Intergenic
947712521 2:232324149-232324171 AGAAGCTGTGTACCCAACCATGG - Intronic
947731486 2:232433829-232433851 AGAAGCTGTGTACCCAACCATGG - Intergenic
947922789 2:233892953-233892975 ATCAGCTGTCTGCCCCTCCAGGG + Intergenic
1173139445 20:40469573-40469595 AGAAGGTGTCTGGTCAACCTAGG - Intergenic
1174118481 20:48244359-48244381 AGAAACTGCCTGTCCAACCTTGG + Intergenic
1176707172 21:10125353-10125375 ATAGGCTTTCTGCCCACCATGGG - Intergenic
1179797538 21:43794149-43794171 ATATGCTGTCTGCACAATCCTGG - Intronic
1179922523 21:44514847-44514869 AGGAGCTGGCTGCCCACCCTGGG - Intronic
1180291050 22:10851785-10851807 ATAGGCTTTCTGCCCACCATGGG - Intergenic
1180493853 22:15881210-15881232 ATAGGCTTTCTGCCCACCATGGG - Intergenic
1181998985 22:26904640-26904662 ACATGCTGTGTGCCCAGCCTGGG - Intergenic
1184915825 22:47568340-47568362 AGCAGCTGCCTGTCCAACCTTGG + Intergenic
950377837 3:12586176-12586198 GTAAGCTGTCAGGCCATCCTTGG - Intronic
956763762 3:72466466-72466488 ATCAGCCTTCTGCCCAACATTGG - Intergenic
961789637 3:129366348-129366370 GTAAGCTGGCTGCCTCACCTGGG + Intergenic
966674536 3:182571288-182571310 ACTAGCTGTGTGACCAACCTTGG + Intergenic
966932262 3:184683559-184683581 GTATGCTGTACGCCCAACCTGGG - Intronic
968811859 4:2803622-2803644 AGATGCTGTCTGCCTCACCTGGG + Intronic
969930095 4:10622502-10622524 AGAAGGTCTTTGCCCAACCTTGG + Intronic
970374477 4:15442709-15442731 ATAAGCTGTCTGCCCAACCTGGG - Exonic
971138451 4:23897016-23897038 ATGAGCTTTCTGCCCAAGCACGG - Intronic
973795282 4:54419034-54419056 ATCAGCTGCCTGTCCAGCCTTGG + Intergenic
992292573 5:75294179-75294201 ATAAGCTGTTTCCCAATCCTAGG - Intergenic
992904176 5:81329181-81329203 AAATGCTGTCTGCCTAGCCTAGG - Intergenic
996074201 5:119170389-119170411 AAAAGCTGGCTGCCCAATGTTGG + Exonic
996370310 5:122746307-122746329 ATGAACTGTTTGCCCAGCCTGGG + Intergenic
1003809012 6:9758922-9758944 CTAGTCTGTCTGCCCAACATAGG - Intronic
1005269502 6:24148170-24148192 TTGAGATGTCTGCCCAACCCAGG - Intronic
1006600672 6:35223472-35223494 ATAAACTATTTGCCCAAGCTGGG - Intronic
1008734030 6:54520302-54520324 ATAGGAAGTCTCCCCAACCTGGG + Intergenic
1013551419 6:111211284-111211306 ATAATCTGTCTGCCCTATCTAGG - Intronic
1018089249 6:160331417-160331439 AGCAGCTGCCTGTCCAACCTTGG + Intergenic
1020146111 7:5644737-5644759 TTAAGCTATCTGCCCGACCTTGG + Intronic
1021574032 7:22091258-22091280 AAAAGCAGGCTGCCCAAGCTAGG + Intergenic
1022309187 7:29179155-29179177 ATAAGCCTTATGCCCAAGCTTGG - Intronic
1024061628 7:45702952-45702974 GGAAGGTGTCTGCCCCACCTGGG + Intronic
1026274997 7:68868988-68869010 AAAAGCTCTCTGCCTAACATGGG + Intergenic
1029834596 7:103296252-103296274 AAGACCTGTCTGCCCAACCCAGG - Intergenic
1030051587 7:105542535-105542557 ATTTGCTGACTGCGCAACCTTGG + Exonic
1034413147 7:150951624-150951646 ATCGGCTGGCTGCACAACCTGGG - Exonic
1041136501 8:54764602-54764624 ATAAGACATCAGCCCAACCTTGG - Intergenic
1042413695 8:68494425-68494447 GAAAGATGTCTGCCCAACATTGG + Intronic
1044449292 8:92314694-92314716 ATCAGCTCCCTGCCCAACTTTGG - Intergenic
1046816163 8:118586099-118586121 ATGAGCTGGCTCCCCAACCAAGG + Intronic
1047165714 8:122436228-122436250 ATGAGCTGCCTGCTCAAACTGGG + Intergenic
1048937979 8:139372729-139372751 ATATGCTGTTTGTCCCACCTGGG - Intergenic
1202791918 9_KI270719v1_random:94227-94249 ATAGGCTTTCTGCCCACCATGGG - Intergenic
1191595215 X:62936166-62936188 GCAAGTTCTCTGCCCAACCTTGG + Intergenic
1194847498 X:98828510-98828532 ATTAGCTCTCTGCACAGCCTTGG - Intergenic
1195109743 X:101635726-101635748 CAAAACTGTGTGCCCAACCTAGG - Intergenic
1196935442 X:120726005-120726027 ATCAGCTGCCTGTCCAGCCTTGG - Intergenic
1200297289 X:154933361-154933383 ATAAGCTATCTGGCCAAGTTGGG + Intronic
1201052638 Y:9953749-9953771 ATAGTCTGTCTTTCCAACCTTGG - Intergenic