ID: 970379518

View in Genome Browser
Species Human (GRCh38)
Location 4:15492917-15492939
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 116
Summary {0: 3, 1: 2, 2: 13, 3: 13, 4: 85}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
970379518 Original CRISPR GCATCAGAGGGCCCCCTCAA GGG (reversed) Intronic
900994444 1:6112846-6112868 GGTCCAGAGGGCACCCTCAAGGG + Intronic
901443726 1:9294387-9294409 GAACCAGAGGGCCCCCTGGATGG - Intronic
901678051 1:10898321-10898343 GGGTCAGAGGGCCCCCTCAAGGG + Intergenic
902984763 1:20148699-20148721 GCAACAGAGGCCCCACTCAGAGG - Exonic
903287625 1:22286628-22286650 CCAACTGAGGGCCCCCTCACTGG - Intergenic
904707483 1:32402303-32402325 GCATCGGAGGCCACCCTCAAGGG - Intergenic
907089017 1:51707332-51707354 GCACCAGAGGGCCCCCTAAAGGG - Intronic
907514725 1:54986356-54986378 GCATCCCAGGGCCACCTCGATGG + Exonic
910900460 1:92114994-92115016 GCATCAGAGGGGGCCCTCAAGGG - Intronic
913227656 1:116714026-116714048 GCATCAGAGGGCCCCCTCAAGGG - Intergenic
913499865 1:119462222-119462244 ACATCAGAGGATCCCCTCAAGGG - Intergenic
913510688 1:119558944-119558966 GCATCAGAGGGTCCCCATAAGGG - Intergenic
913514906 1:119596360-119596382 GCATCAGAAGGCCCCCATAAGGG - Intergenic
915315564 1:155026827-155026849 GCATCAGAGGCCCCCAGCCAAGG - Intronic
915466392 1:156100826-156100848 CCATTAGAGGGACTCCTCAAGGG - Intronic
917220932 1:172727813-172727835 GCAACACAGGGCACTCTCAAGGG - Intergenic
920147711 1:203876565-203876587 GCATCAAAGGACCCAATCAATGG - Intergenic
921957994 1:221003831-221003853 GCAAAAGAGGGCACCCTAAAGGG - Intergenic
1067090632 10:43264407-43264429 GTATCAGAGGCCCTCCTCTATGG + Intronic
1067214974 10:44293833-44293855 CCACCTGAGGGCCCCCTGAAAGG + Intronic
1068338347 10:55667540-55667562 GCATCGGAGGGCCCGCTCAAGGG - Intergenic
1069116690 10:64515949-64515971 GGATCAGAGGGCCCTCTAAGGGG + Intergenic
1069849216 10:71394284-71394306 TCCTCAGAGGGCCCCATCACAGG + Intergenic
1070559506 10:77555216-77555238 GAGTCAGACGGCCCCCTCACAGG + Intronic
1078665352 11:13320369-13320391 GAAGCTGAGGGCACCCTCAAAGG - Intronic
1081660019 11:44882321-44882343 GCCTCAGGGAGCCTCCTCAATGG - Intronic
1082009099 11:47438332-47438354 GAGTCAGAGAGGCCCCTCAAAGG - Intronic
1083615545 11:64024357-64024379 AAATCATAGGACCCCCTCAACGG - Intronic
1083700991 11:64477590-64477612 GCCTCAAAGGGCTCCCTCGATGG + Intergenic
1086581794 11:88408371-88408393 GCATCAGAAGGCCCCTTCAAGGG - Intergenic
1088369057 11:109068487-109068509 TCATCACCTGGCCCCCTCAAAGG - Intergenic
1092193928 12:6537851-6537873 GCGTCGGAGGGCCCCCTCAAGGG + Exonic
1094852296 12:34387705-34387727 GCAGCAGAGGTCCCCCACCATGG - Intergenic
1094855235 12:34399949-34399971 GCATCAGAGGTCCCCTGCAACGG + Intergenic
1094871143 12:34599898-34599920 GCAGCAGATGTCCCCCCCAAGGG + Intergenic
1103955488 12:124574168-124574190 GCACAGGAGGGCCCCATCAAGGG + Intergenic
1105547122 13:21359103-21359125 GTATCGGAGGGCCCCCTCAAGGG + Intergenic
1106388077 13:29307570-29307592 GTGTCAGAGGGCCCCCTCAAGGG + Intronic
1114450157 14:22820034-22820056 GCATCAGAGGTCACTGTCAATGG - Intronic
1115444127 14:33469946-33469968 GCATCAGGGGGCCAGCTCAAGGG + Intronic
1118738550 14:68720994-68721016 GCTCCAGGGGGCCCCATCAAGGG + Intronic
1122048644 14:99040731-99040753 CCATCAGAGGGCACCCACGAAGG - Intergenic
1124632909 15:31347454-31347476 GCGTCAAAGGGCACCCTCAGGGG + Intronic
1128668874 15:69559327-69559349 TCATCAGAGGGACCTCTCCAAGG - Intergenic
1132358737 15:101193922-101193944 GCAACAGAGGGCACCAGCAAGGG + Intronic
1141278035 16:82605841-82605863 GCATCAGAGGTCCTCTTCTATGG + Intergenic
1141436392 16:84002105-84002127 GCACCAGAGCACCCCCTCCACGG + Intronic
1147917607 17:43898138-43898160 GCACAAGAGGCCCCCCTGAAGGG - Intronic
1153341305 18:3977836-3977858 GCATCAGAGGGGACCCTTGAGGG - Intronic
1164879018 19:31715186-31715208 GCATCGGTGGAACCCCTCAAAGG - Intergenic
1166969919 19:46559427-46559449 GCATTGGAGGACCCCCTCAAGGG + Intronic
925418164 2:3688176-3688198 GCATTGGAGGGCCCCCTCAAGGG - Intronic
927967488 2:27280437-27280459 GCAGCAGAAGGCACCCTCACTGG - Exonic
932416018 2:71574355-71574377 ACATACCAGGGCCCCCTCAAGGG - Exonic
937326501 2:120992807-120992829 CCATCAGAGGGCCCACCAAAGGG - Intergenic
938473718 2:131589403-131589425 GCATCCCAGGGCACCCTCAGTGG - Intergenic
939517187 2:143183466-143183488 GCATCAGTGGGCACCATCAGAGG + Intronic
946321333 2:218956108-218956130 GCTTTAGAGGGGCCCCTGAAAGG - Intergenic
948787646 2:240361139-240361161 GCATCTGAAGGCGCCCTCCACGG + Intergenic
1168889338 20:1284117-1284139 GCACCAGAGGGTCCCCTCTAAGG - Intronic
1170169317 20:13393465-13393487 GTGTCAGAGGGCCCCCTCAAGGG + Intronic
1170978288 20:21187369-21187391 TCATCTGAGTGCCCCCTCAGTGG + Intronic
1173639767 20:44592710-44592732 GCTTCAGAGGCTCCTCTCAAAGG - Intronic
1174289317 20:49496477-49496499 CCATCAGAGGGTCCCCACAGAGG + Intergenic
1177557983 21:22716210-22716232 GCCTCAGAGCCACCCCTCAAAGG + Intergenic
1178096708 21:29223070-29223092 GCATTGGAGGGCCCCTTCAAGGG + Intronic
1179908334 21:44435489-44435511 CCATTAGAGGGCACCCTCCACGG + Intronic
1181498769 22:23303444-23303466 ACATCAGAGACCCCCCTGAATGG - Intronic
1181596067 22:23915603-23915625 GCATCAGAGTTCCCTCTCAGAGG + Intergenic
951472503 3:23071357-23071379 GAAACAGATGGCCCACTCAAAGG + Intergenic
951682760 3:25311607-25311629 GCAGCTGAGGGCTTCCTCAAAGG + Intronic
952963547 3:38607615-38607637 GTCACAGAGGGCCACCTCAAAGG - Intronic
955126518 3:56117583-56117605 GGATAAGAGGACTCCCTCAAGGG + Intronic
961814553 3:129542831-129542853 GGATTAGAGGGCCGCCTCAGCGG + Intergenic
962264260 3:133934405-133934427 GCCTCAGTGGGCATCCTCAATGG + Exonic
963292196 3:143503461-143503483 GCTTTGGAGGGTCCCCTCAAGGG - Intronic
967240702 3:187436606-187436628 GCCACAGAGGACCCCCTCACAGG - Intergenic
968292490 3:197549460-197549482 GCAGCAGGGGCTCCCCTCAAAGG + Intronic
968801471 4:2745974-2745996 GCAGCTGGGGGCCCCCTCACTGG - Intronic
970379518 4:15492917-15492939 GCATCAGAGGGCCCCCTCAAGGG - Intronic
976628051 4:87207877-87207899 ACATCGGAGGGCCCCCTCAAGGG + Intronic
977720992 4:100240216-100240238 GCCTCAGAGTCACCCCTCAAGGG + Intergenic
979642351 4:123023899-123023921 GCCTCGGAGGGCCCCCAGAACGG - Intronic
986383311 5:7207900-7207922 GCTTCAGAGGGCCACTGCAATGG + Intergenic
988840765 5:35081486-35081508 GCATCGGAGGGCCCCTTCATAGG + Intronic
990575407 5:57119100-57119122 GGTTCAGAGAGCTCCCTCAATGG + Intergenic
990577605 5:57138228-57138250 GAATCAGAGGAGCCCTTCAAGGG - Intergenic
997090182 5:130847283-130847305 GCCTCAGAGGGCCCCTGGAAAGG + Intergenic
997247894 5:132366729-132366751 ACATCACATGGACCCCTCAAAGG + Intergenic
1001984575 5:176061961-176061983 GCCTCGGAGGGCACCCTCAGAGG + Exonic
1002232940 5:177782236-177782258 GCCTCAGAGGGCACCCTCAGAGG - Exonic
1002263052 5:178007583-178007605 GCCTCGGAGGGCACCCTCAGAGG + Intronic
1003404557 6:5817610-5817632 GTATTGGAGGGCCCCCTCAAGGG - Intergenic
1005932457 6:30493770-30493792 GCCACAGAGGGCCCCCACCAGGG + Exonic
1007063723 6:38968323-38968345 GCTTCAGAGGGCACCATCAGAGG + Intronic
1009895737 6:69746636-69746658 GCATTGGAGGGTCCCTTCAAAGG + Intronic
1010781829 6:79953198-79953220 GCATCAGAGGGCCCCCTCAAAGG - Intergenic
1011071809 6:83393195-83393217 GCGTCAGAGGACCCCCTCAAAGG + Intronic
1016303018 6:142652732-142652754 GCAGCAGAGAGTCCCCTGAATGG - Intergenic
1018658691 6:166065082-166065104 GCATCAGAGGGCTCCCTCTAGGG + Intergenic
1020551778 7:9615770-9615792 GCATCAGAGGGCTCCCTCAAGGG + Intergenic
1021092646 7:16501719-16501741 GCAGAAGAGGGCCCCCGCCAGGG + Intronic
1024095506 7:45979486-45979508 GCATCTGTGGTCCTCCTCAAGGG + Intergenic
1029988769 7:104944313-104944335 CCATCTGGGGACCCCCTCAAAGG + Intergenic
1034172378 7:149072138-149072160 GCACCAGAGAGGCCACTCAAAGG - Exonic
1043458917 8:80439783-80439805 GGATGAGAGGGCACCCTGAAGGG - Intergenic
1052366669 9:27619726-27619748 GCAGCAAAGGGCCCCATTAATGG + Intergenic
1053480972 9:38415918-38415940 CCATCTGAGGGCCCTCTGAAGGG + Intronic
1057859036 9:98625133-98625155 GCAGCAGAGGGCCCCACAAAGGG + Intronic
1061264783 9:129498504-129498526 GCATCAGAGGCCCACCTCTCTGG - Intergenic
1061424218 9:130489077-130489099 GCGTCTGAGGGCCCCTTCAAAGG + Intronic
1062612394 9:137380794-137380816 GCACCAGAAGGCCCCCCCGAGGG + Intronic
1185629428 X:1505315-1505337 GCAACAGAGGGCCTCGTCACCGG + Intronic
1189248012 X:39578530-39578552 CCATCAGAGGAACCCCTCATGGG - Intergenic
1189276114 X:39787325-39787347 GCATCGGAGGGCCCCCTCAAGGG - Intergenic
1189349060 X:40263518-40263540 CCATCAGATGCCCCCATCAAAGG - Intergenic