ID: 970385679

View in Genome Browser
Species Human (GRCh38)
Location 4:15554300-15554322
Sequence GTAGTCAGCAAGGTTGAGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 126
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 117}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
970385679_970385685 13 Left 970385679 4:15554300-15554322 CCCAGCTCAACCTTGCTGACTAC 0: 1
1: 0
2: 0
3: 8
4: 117
Right 970385685 4:15554336-15554358 GATCTCCAGGTGTCCAAAGCTGG No data
970385679_970385683 0 Left 970385679 4:15554300-15554322 CCCAGCTCAACCTTGCTGACTAC 0: 1
1: 0
2: 0
3: 8
4: 117
Right 970385683 4:15554323-15554345 TGTGGCTTCCTTTGATCTCCAGG 0: 1
1: 0
2: 1
3: 25
4: 247

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
970385679 Original CRISPR GTAGTCAGCAAGGTTGAGCT GGG (reversed) Intronic
900699918 1:4040428-4040450 GCAGCCAGGAAGCTTGAGCTGGG + Intergenic
907529089 1:55075230-55075252 TTAGTCAGGAAGGTGTAGCTTGG - Intronic
914246996 1:145893592-145893614 GTGGTCAGCACCTTTGAGCTGGG - Exonic
917762616 1:178179522-178179544 GTAGTGAGCAAAGTTGAGGGAGG + Intronic
917903980 1:179571723-179571745 GTAGCCAGGAAGCTTGAACTGGG - Intronic
918044789 1:180935378-180935400 GTAGTCGGCGAGGTCGGGCTTGG - Exonic
920678803 1:208057458-208057480 GTGGTGAGAAAGGCTGAGCTGGG + Intronic
923013258 1:230105618-230105640 GTGGTCAGCACGGATGAGGTGGG + Intronic
1065220402 10:23490786-23490808 GGAGTCAGCAAGGCTGAGTTTGG + Intergenic
1069775525 10:70925066-70925088 TGAGTCAGCAAGGCTGGGCTGGG + Intergenic
1073313842 10:102564138-102564160 GAAGTCAGGAAGGTTGAGTGAGG + Intronic
1077474585 11:2780354-2780376 GAAGTCAGCAGGATTGCGCTTGG - Intronic
1077992535 11:7424785-7424807 GTATGCACAAAGGTTGAGCTTGG - Intronic
1079286866 11:19142121-19142143 GTTGACATCAAGGCTGAGCTTGG + Intronic
1080858497 11:36132852-36132874 TTAGTCAGCAGGTTTGAGTTTGG + Intronic
1081135363 11:39433678-39433700 GTATTCAGCTAGTTTGAGCCTGG + Intergenic
1083003659 11:59321140-59321162 GCAGTCAGGAAGCTTGAACTGGG - Intergenic
1086834853 11:91607955-91607977 GAAGACAGCAAGATTAAGCTAGG - Intergenic
1087417251 11:97872298-97872320 GCAGACAGCAAAGTTGTGCTGGG - Intergenic
1088917738 11:114240113-114240135 GCAGTCAGGAAGGCTGAGCAGGG - Intronic
1089991536 11:122865690-122865712 GTATTTAGCAATGTTGAGTTTGG - Intronic
1090255237 11:125279220-125279242 GCAGTGAGCAAGGTTGTGCCTGG + Intronic
1090959110 11:131540002-131540024 GTAGTGAGCAAGGATGAGGTGGG - Intronic
1093992875 12:25609999-25610021 GTAGCCAGAAAGCTTGAACTCGG - Intronic
1095246599 12:39930252-39930274 GTAGGCAGCAAGGTGGAGGAGGG + Intronic
1096544911 12:52331407-52331429 GGTGTCAGCTAGGATGAGCTAGG - Intergenic
1097612246 12:61838533-61838555 GTAGTCAGGCAGGGAGAGCTAGG + Intronic
1109566385 13:64121139-64121161 GCAGTCAGGAAGCTTGAACTGGG - Intergenic
1112195321 13:97220100-97220122 GAAGTCAGCAAGTTTGTGCATGG + Intergenic
1114933930 14:27509172-27509194 GGAGAAAGCAAGATTGAGCTGGG - Intergenic
1117242843 14:53852545-53852567 GTAGTCAGAAAGTTTGCCCTTGG - Intergenic
1122116849 14:99532043-99532065 GTGCTCAGCATGGTTGAACTGGG - Intronic
1122706255 14:103624028-103624050 GTACCCAGCCAGGCTGAGCTTGG + Intronic
1123071930 14:105646230-105646252 GCAGTTGGCAAGGGTGAGCTGGG - Intergenic
1124998122 15:34743862-34743884 ATTGTCAGGAAGGTTGACCTGGG - Intergenic
1126963495 15:54025212-54025234 GAAGTCATCATGGTTGAGTTAGG - Intronic
1127527075 15:59803833-59803855 GCAGTCAGGAAGCTTGAACTGGG + Intergenic
1127707364 15:61560453-61560475 GTTGACAGCAGGGCTGAGCTGGG - Intergenic
1128854147 15:70993028-70993050 GCAGCCAGCAAGCTCGAGCTGGG - Intronic
1131363789 15:91819850-91819872 CTGGTCAGGAAGGTTGAGCAAGG + Intergenic
1131731096 15:95282201-95282223 GTAGTTAGCAAGGGTGAGTTGGG + Intergenic
1137074403 16:35944184-35944206 GTGGCCAGGAAGGTTGAACTGGG + Intergenic
1139826243 16:69759549-69759571 GTGGTGAGAAAGGTTGAGCCAGG - Intergenic
1140809018 16:78559102-78559124 GTAGTGGGGAAGGGTGAGCTTGG + Intronic
1141073926 16:80985080-80985102 GAAGTGAGCAAGGTGGATCTGGG + Intronic
1141183432 16:81770266-81770288 GTAGTCAGAACGGTTGCCCTTGG - Intronic
1142869503 17:2810876-2810898 CTAGTCACCCAGGCTGAGCTTGG + Intronic
1143728282 17:8865261-8865283 GAAGCCAGCAATGGTGAGCTGGG - Intronic
1144058865 17:11563549-11563571 GTGGGCAGCAAAGTTGAGCAGGG - Exonic
1149667058 17:58372385-58372407 GTAGTGAGCAAGGTTTAGTGTGG + Intronic
1151058648 17:71064474-71064496 GTAGTGAGCAAGGTGAAGGTGGG + Intergenic
1151070368 17:71203473-71203495 GTAAGCAGCAAGGCTGAGTTGGG + Intergenic
1152937509 17:83148949-83148971 GGAGTCAGCAAGGGTGCACTGGG - Intergenic
1158389601 18:57034328-57034350 GCAGACAGAGAGGTTGAGCTGGG - Exonic
1159176450 18:64841543-64841565 GCAGGCAGAAAAGTTGAGCTAGG - Intergenic
1159629803 18:70736330-70736352 GTGGCCAGGAAGCTTGAGCTCGG + Intergenic
1162937695 19:13989727-13989749 GGAGCCATCAGGGTTGAGCTAGG + Intronic
1163940023 19:20482912-20482934 GCAGTCAGGAAGCTTGAACTGGG + Intergenic
1164571481 19:29377897-29377919 ATAGCCTGCAAGGTTGGGCTAGG - Intergenic
1164708821 19:30339930-30339952 GTATCCTGCAAGGGTGAGCTGGG + Intronic
1166957278 19:46472927-46472949 ATGGGCAGCAAGGTTGAGGTAGG - Intergenic
1166975596 19:46603343-46603365 GTAATCAGCAAGGTAGAGGTGGG + Intronic
927636929 2:24823287-24823309 GAAGTCAGCAAAGTTGGGCAGGG + Exonic
932701651 2:73996332-73996354 ATAGCCAGCCAGGTTGAGCAGGG - Intronic
933641209 2:84762147-84762169 GTAATCATCAAGGCTGAGGTTGG + Intronic
933987040 2:87600835-87600857 GAAGACAGCAAGGTGGTGCTTGG - Intergenic
936306802 2:111349973-111349995 GAAGACAGCAAGGTGGTGCTTGG + Intergenic
936449628 2:112624467-112624489 GTAGTCATCAACGTTGACCCAGG + Intergenic
939679207 2:145109448-145109470 GGAGTCAGCAGGGAAGAGCTAGG - Intergenic
940327035 2:152436257-152436279 CTAGTCAGCAGGCTTGAGCCTGG - Intronic
941731126 2:168919466-168919488 GTAGTCAGCTAGATTGAGGCAGG - Intergenic
945989296 2:216380290-216380312 GTAGGCAGCAGGGTGGTGCTGGG - Intergenic
947703599 2:232256582-232256604 GTGGAAAGCAAGGTTGAGGTTGG - Intronic
1171814100 20:29768180-29768202 GTAGCCAGGAAGCTTGAACTGGG + Intergenic
1178310157 21:31523537-31523559 GTAAACAGCTAGGTTGAGCCTGG - Intronic
1182469003 22:30535657-30535679 GTACTGAGCAAAGATGAGCTAGG + Intronic
1183395041 22:37566717-37566739 GTAGGCGGCCTGGTTGAGCTGGG - Exonic
949182024 3:1144073-1144095 CTATTCAGCAAGCATGAGCTAGG - Intronic
949550162 3:5105809-5105831 GTAGTCTGCGAGGGTGAGGTGGG + Intergenic
950501374 3:13365958-13365980 GTAGGCAGCAATGGTGATCTTGG + Exonic
954837373 3:53481513-53481535 GGATTCAGCAGGGCTGAGCTGGG - Intergenic
959612602 3:108312353-108312375 GTAGTCTGCAAGGTCCAGCCAGG - Intronic
960508111 3:118517208-118517230 GTAGCCAGGAAGCTTGAACTGGG + Intergenic
961930062 3:130523625-130523647 GGATTCAGCAAGGTAGAACTAGG + Intergenic
964765135 3:160172253-160172275 GCAGTCAAAAAGGGTGAGCTGGG - Intergenic
965607105 3:170508466-170508488 GTAGGCAGGAAGGTTGGGGTGGG + Intronic
967767276 3:193294823-193294845 GTTGTGAGCATGTTTGAGCTAGG - Intronic
969260068 4:6027833-6027855 TTAATCAGCAAGGATGACCTTGG + Intronic
969433054 4:7167225-7167247 ACAGTCAGCAAGGGTGAGCTGGG - Intergenic
970385679 4:15554300-15554322 GTAGTCAGCAAGGTTGAGCTGGG - Intronic
970389884 4:15597972-15597994 GAAATCAGAAAGGTTGGGCTGGG - Intronic
970882307 4:20946436-20946458 CGAGTTAGCAAGGTTGAGCTAGG + Intronic
973275654 4:48304695-48304717 GTATTCAGCAAGGTGGCGTTGGG + Intergenic
986595133 5:9413436-9413458 GTATTGAGCAAGATGGAGCTAGG + Intronic
986923979 5:12723408-12723430 GTAGTCAACAAACTTCAGCTGGG - Intergenic
1002771015 6:291363-291385 GAAGTCAGCAGGGGTGAGCCAGG + Intergenic
1006941884 6:37757368-37757390 GTTGTCAGAAATGCTGAGCTCGG - Intergenic
1010961535 6:82151381-82151403 GCAGTCAGGAAGCTTGAACTAGG + Intergenic
1011595238 6:89009735-89009757 GCAGCCTGTAAGGTTGAGCTGGG + Intergenic
1014826229 6:126051242-126051264 GTAGTTAGCCAGGTTAAGCTGGG + Intergenic
1017186731 6:151609015-151609037 GCAGTCAGCCAGGATCAGCTTGG - Intronic
1022921470 7:35020019-35020041 CTACTCAGGAAGGCTGAGCTGGG + Intronic
1027440552 7:78214998-78215020 GTAGTCAGTAAGGTTCCTCTTGG - Intronic
1029862103 7:103583727-103583749 GTAGCCAGCATGGCTGAGATTGG + Intronic
1036573554 8:10003085-10003107 GGAGAGAACAAGGTTGAGCTGGG - Intergenic
1036752726 8:11453608-11453630 GGAGCCAGGAAGGCTGAGCTGGG + Intronic
1037298974 8:17431623-17431645 CTACTCAGCAAGGCTGAGGTGGG + Intergenic
1039839265 8:41281822-41281844 GTGGTCAGCAAGGTTGGGAGGGG - Intronic
1039958290 8:42223914-42223936 GTAGGCTGCAAGGGTGAGATGGG - Intergenic
1041546064 8:59044417-59044439 GTAGTCAGCAAGGGACAGGTGGG - Intronic
1043959530 8:86400775-86400797 AAAGTGAGCAAGGATGAGCTTGG + Intronic
1045760813 8:105604561-105604583 GAAGTCAGCAAGGCAGAGATTGG - Intronic
1048896536 8:138997436-138997458 TTAGTCAGGAATGTTGAGATGGG - Intergenic
1057303615 9:93900169-93900191 GGAGTCTGCAAGGCTGAGCTGGG - Intergenic
1057457501 9:95227759-95227781 GTACTCAAGAAGGTTTAGCTGGG - Intronic
1061076385 9:128343933-128343955 GTAGTGAGCAAGGCTGTGCCAGG - Intronic
1061232897 9:129325245-129325267 GTCTTCAGCAAGGCTCAGCTTGG + Intergenic
1062461249 9:136663421-136663443 GTTGGCAGCAAAGTTCAGCTTGG + Intronic
1203492078 Un_GL000224v1:116645-116667 GTGGTCAGGAAGCTTGAACTGGG - Intergenic
1203504702 Un_KI270741v1:58517-58539 GTGGTCAGGAAGCTTGAACTGGG - Intergenic
1188660795 X:32755916-32755938 GTAATCAGCAAGCTTAATCTAGG + Intronic
1188876625 X:35438939-35438961 GTAGACACCAAGGGTGAGGTTGG + Intergenic
1193407279 X:81117489-81117511 GTACTCTGGAAGGTTGAGATGGG - Intronic
1195715748 X:107817215-107817237 GTAGTGAGCAAGGGTGAGAGTGG + Intergenic
1196199072 X:112865132-112865154 AAAGTCAGGAAGGTTGAACTTGG + Intergenic
1197316845 X:124977071-124977093 GGAGTCAGGAAGTCTGAGCTTGG + Intergenic