ID: 970389373

View in Genome Browser
Species Human (GRCh38)
Location 4:15592165-15592187
Sequence TTGGATGGAATAGTGGAGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 191
Summary {0: 1, 1: 0, 2: 2, 3: 22, 4: 166}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
970389373_970389380 28 Left 970389373 4:15592165-15592187 CCATGCTCCACTATTCCATCCAA 0: 1
1: 0
2: 2
3: 22
4: 166
Right 970389380 4:15592216-15592238 CTCTATCTATTGATACGCTCAGG 0: 1
1: 0
2: 0
3: 2
4: 36
970389373_970389381 29 Left 970389373 4:15592165-15592187 CCATGCTCCACTATTCCATCCAA 0: 1
1: 0
2: 2
3: 22
4: 166
Right 970389381 4:15592217-15592239 TCTATCTATTGATACGCTCAGGG 0: 1
1: 0
2: 0
3: 4
4: 52
970389373_970389382 30 Left 970389373 4:15592165-15592187 CCATGCTCCACTATTCCATCCAA 0: 1
1: 0
2: 2
3: 22
4: 166
Right 970389382 4:15592218-15592240 CTATCTATTGATACGCTCAGGGG 0: 1
1: 0
2: 0
3: 4
4: 33

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
970389373 Original CRISPR TTGGATGGAATAGTGGAGCA TGG (reversed) Intronic
901532033 1:9859695-9859717 GTGGATGAAAGAGAGGAGCATGG + Intronic
901951000 1:12746520-12746542 TTGGATGGAAGAGAGGAGAAAGG + Exonic
902216309 1:14936505-14936527 ATGGCTGGCACAGTGGAGCAGGG - Intronic
904851906 1:33466048-33466070 TTGAATGGAAGAGTGGGACAAGG - Intergenic
906901310 1:49839624-49839646 TTTGGTTGCATAGTGGAGCATGG + Intronic
909397571 1:75187605-75187627 TTGGCAGGCATAGTGGAGCAAGG + Intergenic
910814576 1:91277415-91277437 TTGGGAGTAATAGTGGGGCAGGG - Intronic
910972103 1:92866439-92866461 TTAGATAGAATAGTGGGGAAAGG - Intronic
910977043 1:92917753-92917775 TGGGAGGAACTAGTGGAGCAAGG + Intronic
911802627 1:102162424-102162446 TTGCATGGAATAATGGAGACAGG - Intergenic
912474220 1:109925389-109925411 GTGGATGGAATGGAGGGGCAGGG - Intronic
913196453 1:116460363-116460385 GTGGATAGAAGAGTGAAGCATGG + Intergenic
915249624 1:154578853-154578875 CTGGATGGAAACCTGGAGCAAGG + Exonic
918060531 1:181057185-181057207 TTACATGGGACAGTGGAGCAAGG - Exonic
918623516 1:186632448-186632470 CTGGATGGAACAAAGGAGCAGGG + Intergenic
919413196 1:197273067-197273089 TTGGATGGGATACTAGAACAGGG - Intronic
920439023 1:205966291-205966313 CTGGGTGGAATGGTGGAGGAGGG - Intergenic
923196264 1:231670971-231670993 TTGGATGGAGGTGGGGAGCAGGG - Intronic
923480873 1:234382201-234382223 CTGGATCGAAAAGTGGACCAGGG + Intronic
1063726170 10:8639805-8639827 ATGTATGGAAGAGAGGAGCAAGG + Intergenic
1065377196 10:25055269-25055291 TTGCATGCAAAAGTTGAGCAGGG + Intronic
1066777605 10:38900074-38900096 TCGGATGGAATAGAATAGCATGG + Intergenic
1070232033 10:74578669-74578691 TTGGTTGGAAGAGAGGACCAGGG + Intronic
1072076641 10:91981645-91981667 TTGGATGGAACTGTTGAGTAAGG + Exonic
1073632919 10:105166577-105166599 TTGGATGGAATACTGAATAAGGG + Intronic
1073670431 10:105581405-105581427 TTGGATGGAATAATAGAATAAGG - Intergenic
1075391152 10:122093229-122093251 TTGGATTGAAAAGTGGAGGGAGG + Intronic
1075720576 10:124584312-124584334 TGGAATGCAATAGTGGATCATGG - Intronic
1076803213 10:132842331-132842353 TCAGATGGAACTGTGGAGCAAGG - Intronic
1077669159 11:4142065-4142087 TTGGATTTAATATTGCAGCATGG + Intergenic
1078313775 11:10273785-10273807 TTGGATGGAAAACTGGAACCAGG + Intronic
1081331596 11:41807535-41807557 AAGGAAGAAATAGTGGAGCAAGG + Intergenic
1085938185 11:81175726-81175748 ATTTATGGAATAGTAGAGCAGGG - Intergenic
1089183532 11:116599087-116599109 TTGCCTGGAAAAGAGGAGCATGG - Intergenic
1089222158 11:116882205-116882227 TTGGATGGATTAATGAGGCAGGG + Intronic
1090212206 11:124929125-124929147 TTGGATGGGATAGGAGAGCATGG - Intronic
1090348942 11:126094432-126094454 TAGGATGGAAGTGTGGAGCAGGG + Intergenic
1090728224 11:129546653-129546675 TTGAATGGATTAGTGGAAAAAGG + Intergenic
1094773796 12:33697603-33697625 TTGAATGCAAAAATGGAGCAAGG - Intergenic
1096723388 12:53541288-53541310 TTGCATGGTATAGTGAAGCATGG - Intronic
1099822987 12:87737962-87737984 TAGGATGAAACAGTGAAGCATGG + Intergenic
1099936743 12:89135174-89135196 TTGGGTGGACTAGTGCATCATGG - Intergenic
1102829788 12:115987206-115987228 TTGGATGGCATCTTGGAGAAAGG + Exonic
1102935551 12:116893586-116893608 TAGGATGGAGCAATGGAGCAGGG + Intergenic
1103070052 12:117933868-117933890 GTGGATGGAGAACTGGAGCACGG - Intronic
1104092405 12:125527298-125527320 GTGGATGGAAGAGTGGAGGGTGG - Intronic
1104092427 12:125527365-125527387 GTGGATGGAAGAGTGGAGGGTGG - Intronic
1104879346 12:132059343-132059365 TTGGATTGAGTAGTGGAGCATGG + Intronic
1107671520 13:42751096-42751118 ATGGAAGGAATAGAGCAGCAGGG - Intergenic
1108817350 13:54307993-54308015 TTGGAGGGAAGAGCGGAACAGGG + Intergenic
1110205056 13:72902228-72902250 TTGGGGGGAAGAGTGGAACAGGG + Intronic
1116749954 14:48870770-48870792 TTTGATAGAAAAGTTGAGCAAGG - Intergenic
1118820076 14:69339384-69339406 TTGGATGGTATAGATTAGCACGG - Intronic
1119153426 14:72386694-72386716 TAGGATGGTGCAGTGGAGCACGG - Intronic
1121071398 14:91025374-91025396 GGGTATGGAATAGTGGAGAAAGG - Intronic
1122320713 14:100853958-100853980 GTGGATGGAAGAATGGAGGAAGG + Intergenic
1122364531 14:101186747-101186769 TTGGATGGATTAGCGGAGGAGGG + Intergenic
1126501655 15:49352740-49352762 TTGGAGGGACCAGTGGACCAAGG - Intronic
1127633642 15:60849070-60849092 AAGGATGGAATAGAGGAGCTGGG - Intronic
1128676423 15:69612407-69612429 CTGGCTGGAATGGTGGAGCTGGG - Intergenic
1130763087 15:86841088-86841110 TTGGAGAGAATAGAGCAGCAAGG + Intronic
1131512416 15:93056640-93056662 TTGGAGGGAATAGTGGGGCACGG - Intronic
1131838748 15:96415320-96415342 TTGGATTGAAAAGGGGAGGAAGG - Intergenic
1134176748 16:12013061-12013083 TTGGAGGGCAGAGTGAAGCAGGG + Intronic
1142932416 17:3298347-3298369 TTAGTTGGAATGTTGGAGCAGGG - Intergenic
1143218201 17:5240605-5240627 GTGGATGGATTAGTTGAGGAAGG - Intergenic
1143218226 17:5240729-5240751 GTGGATGGATTAGTTGAGGAAGG - Intergenic
1144302094 17:13931063-13931085 TGGGAAGGAAGAGTGGAGAATGG - Intergenic
1145078275 17:19873391-19873413 TTGGATAGAATAGTGGGAGATGG + Intergenic
1145338471 17:21933294-21933316 TTGAATGGAATGGTGTCGCAGGG + Intergenic
1147210829 17:38871485-38871507 CTGGATGGAAGAGAGGTGCAAGG + Intronic
1151118177 17:71762750-71762772 TTGGATGGAATTGGGGTTCAAGG - Intergenic
1152068453 17:78123938-78123960 ATGGATGGATGAGTGGAGCTCGG + Intronic
1152264988 17:79288947-79288969 ATGGATGGAATACAGTAGCAGGG + Intronic
1154121883 18:11658771-11658793 TTGGATTGGATAGAGGAGGAGGG - Intergenic
1157724423 18:49952961-49952983 ATGGAGGGGATAGGGGAGCATGG - Intronic
1158848530 18:61470342-61470364 ATGGAGGGAATAGGGGAACAAGG - Intronic
1159789419 18:72759218-72759240 TTGGATGGCAGAGTGGAGAAGGG - Intronic
1161270819 19:3388262-3388284 CTGGATGGAATTGGGGAGCAAGG + Intronic
1162482319 19:10935302-10935324 TTGGTAGGAATTGTGGAGCTTGG + Intergenic
1166137447 19:40786161-40786183 TTGCATGGGATGGGGGAGCATGG + Intronic
1166930983 19:46301150-46301172 TTGGATGGAGGGTTGGAGCAGGG - Intronic
1167144166 19:47672132-47672154 ATGGATGGAAGGATGGAGCATGG + Intronic
1167580125 19:50336545-50336567 CTGGATGTACTGGTGGAGCAGGG - Intronic
1167583643 19:50360980-50361002 ATGGATGTACTGGTGGAGCAGGG - Exonic
1167638900 19:50669335-50669357 TTCTATGGGATAGTGGAGCAGGG - Intronic
927703053 2:25280208-25280230 TGGGATGGAATGGAGGAGCTGGG - Intronic
928374117 2:30761215-30761237 CTACATGGAATGGTGGAGCAGGG + Intronic
928997353 2:37307114-37307136 TTGGATGCACAACTGGAGCAGGG - Intronic
931819680 2:65938773-65938795 ATGAATGGAAAAGTGGAGAAGGG + Intergenic
933169794 2:79112471-79112493 TTAGATGGAAATGAGGAGCATGG - Intergenic
939261652 2:139818387-139818409 TTGGAGGGAACAGAGGAGGAAGG + Intergenic
940935540 2:159490269-159490291 TTGGATTGAAAAGTGTAACAAGG - Intronic
942612977 2:177761355-177761377 TTGGGTGGAATTTTGAAGCAGGG - Intronic
942804197 2:179910568-179910590 TTGCAGGGAAAAGTTGAGCAAGG + Intergenic
944306963 2:198189488-198189510 CTGGATGGAGTCGGGGAGCAGGG - Intronic
1170732867 20:18989290-18989312 CAGGATGGCATAGTGGAACAAGG - Intergenic
1173388974 20:42614582-42614604 GTTGAGGGAATAGAGGAGCATGG - Intronic
1173861732 20:46288218-46288240 TTGGAGGGGATATTGGAGCCTGG - Intronic
1174737671 20:52981167-52981189 GTGGATGGAACAGCGGAGTAAGG + Intronic
1182150576 22:28024472-28024494 TTGGGTGGAAGTGTGGAGCTTGG - Intronic
950019576 3:9777714-9777736 TTGGATGGAATTGTGAAAGAAGG - Intronic
950684662 3:14607882-14607904 ATGAATGGAACAGTGGAGCTGGG - Intergenic
952743310 3:36755688-36755710 TAGGATGGAGAAGTGGAGGATGG + Intergenic
955683593 3:61527853-61527875 TTGGATGGAATGGGGCAGCTAGG - Intergenic
956196176 3:66655393-66655415 TCTGGTGGAATAGTGGGGCAAGG + Intergenic
956453839 3:69401272-69401294 TTGGATGGAATAGTTGAAGAGGG - Intronic
956683380 3:71802674-71802696 TCTGATGGCATCGTGGAGCATGG - Intergenic
956684951 3:71817670-71817692 TTGGATGGCATAGTGAATGAAGG + Intergenic
959344890 3:105181334-105181356 GTGGATCCATTAGTGGAGCAGGG + Intergenic
960426810 3:117518659-117518681 TTGGAAGAAATAGTGCAGCAAGG + Intergenic
961805501 3:129486599-129486621 TGGAAAGGAAGAGTGGAGCAGGG + Intronic
962210140 3:133470976-133470998 CTGGAAGGAATGGAGGAGCATGG + Intronic
965609973 3:170533162-170533184 TTGGAAGGAGTAGAAGAGCAAGG - Intronic
966100156 3:176258794-176258816 TTAGATGGATTAGTTGAGTATGG + Intergenic
967961264 3:194926295-194926317 TTGGATGGGGCAGGGGAGCAGGG + Intergenic
968062886 3:195739598-195739620 TTGGACGGAAGAGAGGAGCCAGG - Intronic
969464223 4:7345074-7345096 TTGGATGGATTAGAGGGGGAAGG + Intronic
970389373 4:15592165-15592187 TTGGATGGAATAGTGGAGCATGG - Intronic
972642750 4:40940456-40940478 CTGGAAGGAATCTTGGAGCAGGG - Intronic
973209904 4:47604227-47604249 TTGGAAGAAATTTTGGAGCATGG - Intronic
974477633 4:62404730-62404752 CTGCAGGGAATAGAGGAGCATGG - Intergenic
974819058 4:67043432-67043454 TTAGAATGAATAGTGGAGGAGGG - Intergenic
978461107 4:108953198-108953220 TTGCTTGGAACAGTAGAGCAGGG + Intronic
978834113 4:113127176-113127198 CTTGATGGAAAAGTGAAGCATGG - Intronic
981048698 4:140290390-140290412 GTGGATGGAATTGTGGAGGGTGG + Intronic
981644158 4:146979488-146979510 TTGGGTGGAATAGGGCAGCAAGG - Intergenic
986974724 5:13381767-13381789 TTGCCTGGCATAGAGGAGCAGGG - Intergenic
989343264 5:40400848-40400870 TGGGATGGGATAGGGGAGCAGGG + Intergenic
990544374 5:56807724-56807746 TTGGCGGGAATAGGGGATCAGGG - Intergenic
991950848 5:71945711-71945733 TTGGGTGGAATCGTTGACCATGG - Intergenic
992102960 5:73424728-73424750 TTGGAGGGAAGTGTGGAGAAGGG + Intergenic
993487621 5:88505918-88505940 TGGGATGGAATCGGGGGGCAGGG - Intergenic
994427501 5:99610034-99610056 ATGGATGAAATAATGTAGCAGGG + Intergenic
995734601 5:115286619-115286641 TTGGGTGGCATAGTGGGGCCTGG + Intronic
998731789 5:145085983-145086005 CTGGTTGGAATAGTGTAGCGGGG - Intergenic
1000404381 5:160871516-160871538 TTGGAGGGAAAAGTGGAAAAGGG - Intergenic
1000566606 5:162855602-162855624 TCGGATGGACTAGTTGAGTAAGG - Intergenic
1000668739 5:164033499-164033521 ATGCATGGAATAGTGGAGGATGG - Intergenic
1000824733 5:166031056-166031078 ATGGATGGAATGGTGGATCTAGG - Intergenic
1001153264 5:169250878-169250900 ATTGATGGACTAGAGGAGCAAGG - Intronic
1002422208 5:179154544-179154566 TTGGATGTGATAATGGGGCAAGG + Intronic
1005169634 6:22968209-22968231 TTGAATGGCAGAGTGAAGCACGG + Intergenic
1005711434 6:28506659-28506681 TTGGATGGTAAAGTGTAGCCAGG - Intronic
1005905640 6:30260052-30260074 CTGGTTGTAATAGCGGAGCAGGG - Intergenic
1007382132 6:41497249-41497271 TTGCATGGAAGAGAGGAGCAGGG - Intergenic
1008308692 6:49937618-49937640 GTGTATGTAATAGGGGAGCAGGG - Intergenic
1010403480 6:75475443-75475465 TTGTAGGGAATGGTGGAACAAGG - Intronic
1010651240 6:78457631-78457653 TTGGATGAATAAATGGAGCAGGG - Intergenic
1014898366 6:126931746-126931768 TTGGATGGAAAAGTTTAGAAAGG + Intergenic
1018549809 6:164982993-164983015 CTGGATGGAACACTGGAACAGGG - Intergenic
1019857025 7:3619683-3619705 ATGGATGGAATCATGGAGAATGG + Intronic
1020882444 7:13779008-13779030 TTGGATGGAGCACTGGAGCTGGG + Intergenic
1026134427 7:67646940-67646962 GTGGATGGAATACTGGAACACGG - Intergenic
1026171693 7:67959651-67959673 TTGAGGGGAAAAGTGGAGCAAGG + Intergenic
1026906081 7:74063479-74063501 TTCGATGGCACAGTGGAGCCAGG - Intronic
1032633705 7:133682647-133682669 GTGGATGGCATTGTGGAGGAAGG + Intronic
1033918382 7:146356716-146356738 TTGGATGGAGAAGTGGATCATGG + Intronic
1035025673 7:155823851-155823873 ATGGAAAGAACAGTGGAGCACGG - Intergenic
1035044959 7:155957928-155957950 TTGTATAGTATAGTGTAGCATGG + Intergenic
1035044962 7:155958048-155958070 TTGTATGGTATAGTGTAGCATGG + Intergenic
1035044966 7:155958168-155958190 TTGTATGGTATAGTGTAGCATGG + Intergenic
1035044969 7:155958288-155958310 TTGTATAGTATAGTGTAGCATGG + Intergenic
1035824033 8:2625544-2625566 TTTGAGGGTATAGTGGAGTATGG + Intergenic
1038708650 8:29920784-29920806 TTGGATGGAACAGGAGAGTAGGG - Intergenic
1040438116 8:47413133-47413155 TCAGATGGAAAAGAGGAGCATGG + Intronic
1040610086 8:48975603-48975625 TTCCAGGGAATAGAGGAGCAAGG + Intergenic
1041426476 8:57726449-57726471 TGGGAAGGAATTCTGGAGCAGGG + Intergenic
1043584627 8:81754002-81754024 TTGGATGTGATAGTGGAACCTGG + Intronic
1043927683 8:86056508-86056530 TTACATGGAATAGTGAAGAAAGG - Intronic
1047306808 8:123659225-123659247 ATGGATGGATTGGTGGAGGATGG - Intergenic
1048792141 8:138114007-138114029 TTGGATACAAGAGAGGAGCATGG - Intergenic
1051681280 9:19610510-19610532 TTGGATGGAAGAGAGGAACAAGG + Intronic
1053161345 9:35815300-35815322 TTGGAAGGATTAATGGAGCCTGG + Intronic
1056583196 9:87909576-87909598 GTGGATGGAATAGTGGAAGTTGG - Intergenic
1057141147 9:92727526-92727548 ATGGCTGGAGGAGTGGAGCATGG - Intronic
1057159486 9:92877777-92877799 GTGGATGGAATAGTGGAAGTCGG - Intronic
1062260128 9:135657918-135657940 TGGCAGGGAATAGTGGAGCAGGG - Intergenic
1062438462 9:136557469-136557491 CTGGATGGAAGAGTGGAGACTGG - Intergenic
1203348672 Un_KI270442v1:58140-58162 TGGGATGGAATAGAGTAGAAAGG + Intergenic
1203674623 Un_KI270756v1:11466-11488 TCGGATGGAATAGAATAGCATGG - Intergenic
1185493651 X:537974-537996 TTGGAGGGAAAAATGGAGCCAGG + Intergenic
1186799123 X:13075584-13075606 TTGGACGTAATAGTAGAGCTAGG + Intergenic
1187128574 X:16478550-16478572 TTGGAGGGAAGAGAGGAGCCAGG + Intergenic
1187147951 X:16655016-16655038 TCTGGTGGAAAAGTGGAGCAAGG - Intronic
1188165866 X:26862729-26862751 TTGGAAGGCAAAGGGGAGCAAGG - Intergenic
1189543678 X:42019480-42019502 TTTGTTGGAATAGTGGAGGTGGG + Intergenic
1193713242 X:84903808-84903830 ATGGATGGAAAAGTGGAGTGAGG - Intergenic
1197760342 X:130023569-130023591 TTGGATAGAATGGGGAAGCAAGG + Intronic
1201112957 Y:10813827-10813849 TTGAATGGAATATTGTAGAATGG - Intergenic
1201216768 Y:11729634-11729656 TTGGATGGAATGGTGTTGCACGG + Intergenic