ID: 970389993

View in Genome Browser
Species Human (GRCh38)
Location 4:15599213-15599235
Sequence AGGGAGTACTGAATGACTTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 179
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 164}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
970389993_970389998 17 Left 970389993 4:15599213-15599235 CCCCAAGTCATTCAGTACTCCCT 0: 1
1: 0
2: 0
3: 14
4: 164
Right 970389998 4:15599253-15599275 AAGCATCTGTTATAGCTCTTAGG 0: 1
1: 0
2: 0
3: 15
4: 191

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
970389993 Original CRISPR AGGGAGTACTGAATGACTTG GGG (reversed) Intronic
900120704 1:1047543-1047565 AGGGAGTAGGCAAGGACTTGGGG - Intronic
904929458 1:34074844-34074866 AGGGACAACTGAGTTACTTGAGG + Intronic
907707538 1:56845674-56845696 AGGTACAACTGAATGAATTGAGG - Intergenic
909341615 1:74538341-74538363 GGGGAGTATTGAATGACTGGGGG + Intronic
910141775 1:84034025-84034047 AGGGAATACAGAATGAGTAGTGG + Intergenic
910737572 1:90477578-90477600 AGGGAATACTGAAATACTAGGGG + Intergenic
913153763 1:116073593-116073615 AGTGGGTACTGAATGACCTGAGG + Intergenic
914840233 1:151242290-151242312 AGGGAGTACCCAATCACATGGGG - Intronic
915302775 1:154961261-154961283 AGTGAGTACTGAATTCCATGTGG + Intronic
915921240 1:159977363-159977385 AGGTAGTACTGGAAGACGTGAGG + Intergenic
916866469 1:168864928-168864950 AGGGAGTTCTAAATGTCTTGTGG - Intergenic
918426858 1:184419401-184419423 AGGGAGTATTGAATTCCTTATGG + Intronic
923431087 1:233921123-233921145 AGGGAGTTCTATATGTCTTGTGG - Intronic
1064183546 10:13140775-13140797 AAGGAGTGCTGGATGGCTTGTGG - Intergenic
1066957887 10:42190002-42190024 AGGGAATACAGAATGAATAGTGG + Intergenic
1067666319 10:48282618-48282640 AGGGAATACAGAATGAGTAGTGG - Intergenic
1069581226 10:69568470-69568492 AGTGAGCAGTAAATGACTTGAGG - Intergenic
1071998317 10:91168585-91168607 AGGGAGAAGGCAATGACTTGAGG + Intronic
1072300716 10:94059157-94059179 TGAGAGCATTGAATGACTTGGGG + Intronic
1072565532 10:96613866-96613888 AGGGAGCATTGAATGAGTTGGGG - Intronic
1076741499 10:132488062-132488084 AGTGAGTCCTCAATGGCTTGGGG - Intergenic
1077793619 11:5467858-5467880 AGAGAGGATTGAATGACTAGAGG - Intronic
1078544021 11:12233828-12233850 AGGGAGTACTGAAGCAATTTTGG + Intronic
1083182922 11:60999590-60999612 AGGGAGTATTTAATGATGTGGGG - Intronic
1084632260 11:70360845-70360867 AGGGATGTTTGAATGACTTGGGG + Intronic
1088475602 11:110235576-110235598 TGGGAGTATCGATTGACTTGGGG - Intronic
1092198921 12:6568031-6568053 CGGGAGTGCTGAGTGAGTTGCGG - Intronic
1092806912 12:12232473-12232495 TGAGAATTCTGAATGACTTGGGG - Intronic
1096761191 12:53843414-53843436 AGGGACTACTGAATGGAATGCGG + Intergenic
1098928808 12:76385004-76385026 ATGGATTACTGAATGACTATAGG + Intronic
1100578800 12:95919141-95919163 ATTGAGTAATGAATGATTTGTGG + Intronic
1100856212 12:98759354-98759376 AGTGATCACTGAATGACATGGGG + Intronic
1103082988 12:118040223-118040245 TGGGAGTACTGAATAAATTAAGG + Intronic
1104600079 12:130147261-130147283 AGGGAGCACTGAGTGGCTAGTGG - Intergenic
1107687977 13:42923192-42923214 GGGGACCACTGAATGATTTGGGG + Intronic
1109085866 13:57970915-57970937 AGGGAATACTGACTGCTTTGTGG + Intergenic
1109160910 13:58972848-58972870 ATGAAGTTCTGAATGACCTGTGG + Intergenic
1110233649 13:73193674-73193696 ATGGAGTGCTGAACCACTTGAGG - Intergenic
1111720254 13:91934864-91934886 AGAGAAGACTGAATGTCTTGTGG - Intronic
1114664396 14:24369395-24369417 AGGGAGCATAGAAGGACTTGCGG + Intronic
1115627385 14:35207695-35207717 ATGGATTAATGAATGAATTGAGG - Intronic
1116172804 14:41424892-41424914 AGTGAGTACTGGATGTCTAGGGG + Intergenic
1117133499 14:52709296-52709318 AGACACTACTGAATGACTTGAGG - Intronic
1118039361 14:61900657-61900679 AGGTAGCACTGAAGGTCTTGAGG + Intergenic
1118835526 14:69475336-69475358 AGGGAGCACTGAATACCTTCAGG + Intergenic
1119236333 14:73022810-73022832 TGGGAGTACAGAATGACTAGGGG - Intronic
1122212550 14:100182025-100182047 AGGGAGTACTGTACAAGTTGTGG + Intergenic
1202935225 14_KI270725v1_random:81774-81796 AGGGAATACAGAATGAATAGTGG - Intergenic
1123698543 15:22897329-22897351 AGAGAGTGTTGAATGTCTTGGGG + Intronic
1125315088 15:38422473-38422495 ACGGGTTACTGAATGAATTGTGG + Intergenic
1126450800 15:48806573-48806595 AAGGTGTAGTGAATGAGTTGTGG - Intronic
1129409839 15:75344023-75344045 AGGGGGGAGTGAATCACTTGAGG - Intergenic
1129595383 15:76959840-76959862 AGGGAGCACTGAATCTCTTTAGG + Intergenic
1130245210 15:82241198-82241220 AGGGGGAACTGACTGACTTTAGG - Intronic
1130455470 15:84102214-84102236 AGGGGGAACTGACTGACTTTAGG + Intergenic
1137267767 16:46883406-46883428 AGGGAGTTCTGGAAGACTCGGGG - Intergenic
1137778267 16:51074636-51074658 AGGTAAGAGTGAATGACTTGGGG + Intergenic
1138001226 16:53281874-53281896 AAGTAGTAGTGAATGACTGGTGG - Intronic
1138832811 16:60395620-60395642 AGGAAGTACTGAATATCTTCCGG - Intergenic
1139534918 16:67565838-67565860 TGGGACTTCTGAATGGCTTGGGG + Intronic
1143325337 17:6094809-6094831 AGGGAGGAAGGAATGACTTATGG + Intronic
1144587194 17:16494130-16494152 TGGCAGTATTGACTGACTTGTGG + Intergenic
1144785085 17:17827060-17827082 AAGGAGGACTGAATGATATGAGG + Intronic
1146456565 17:33013938-33013960 AGGGAGTGCTGGGTGACTCGAGG + Exonic
1146617947 17:34371632-34371654 TGGGGGTGCTGTATGACTTGAGG - Intergenic
1147436730 17:40421053-40421075 AGGGGGTCCTGCAGGACTTGTGG + Intergenic
1148380452 17:47193073-47193095 AAGGAGGACTGAAAGACTTCAGG - Intergenic
1149424511 17:56542247-56542269 TGTGAGGAATGAATGACTTGAGG - Intergenic
1150737164 17:67750898-67750920 AGGGAGTGCTGATTGGTTTGTGG - Intergenic
1151161346 17:72168423-72168445 AGGAATGAATGAATGACTTGGGG - Intergenic
1152509344 17:80774846-80774868 AGGGAATGATGAATGACTTGAGG - Intronic
1155423108 18:25676976-25676998 AGGAAGCACTGAAGGCCTTGAGG - Intergenic
1156245267 18:35291440-35291462 AGGGAAAAATGAATGACTTTGGG - Intergenic
1158211539 18:55055673-55055695 AGAGAGAACTGAATGTTTTGAGG - Intergenic
1165059716 19:33199153-33199175 TGGGAGGACTGCATGATTTGCGG - Intronic
1165206173 19:34188587-34188609 AGGGATTACTTAATGCCTAGGGG - Intronic
1167238639 19:48330262-48330284 AGGGGGCACTGCATGACGTGTGG + Intronic
1167246333 19:48375434-48375456 AGGGACTGGGGAATGACTTGTGG + Intronic
1167791545 19:51686237-51686259 AGTGAATAATAAATGACTTGTGG - Intergenic
1202676250 1_KI270711v1_random:9484-9506 AGGGAGTCCTGCAAGACTTCAGG + Intergenic
926048544 2:9728145-9728167 AGGGTGGACAGAATGACTTAGGG - Intergenic
930926402 2:56823200-56823222 TGGCAGTACTGCATGACTTCAGG - Intergenic
933259391 2:80115075-80115097 AGGTAGTACTGGATGTCTGGGGG + Intronic
934306004 2:91822519-91822541 AGGGAATACAGAATGAATAGTGG + Intergenic
934327252 2:92030223-92030245 AGGGAATACAGAATGAATAGTGG - Intergenic
934851941 2:97707213-97707235 AGGGAGTACTGAAGTACTGATGG + Intergenic
935619064 2:105112994-105113016 CGGGTGTCCTGAATGACCTGGGG - Intergenic
936244821 2:110817394-110817416 GAGGATTACGGAATGACTTGAGG + Intronic
937784938 2:125885766-125885788 AGGGAATACAGAATGAGTAGTGG - Intergenic
941977501 2:171421776-171421798 AGGGTCAACTGAAAGACTTGAGG + Intronic
943221685 2:185117464-185117486 TGAGAGAACTGAAAGACTTGTGG + Intergenic
947385543 2:229586970-229586992 TGGGAGTGCCGAATGACCTGAGG - Intronic
1170374753 20:15688325-15688347 AGGGAGAACTGGCTGACCTGAGG - Intronic
1174931335 20:54818384-54818406 AAGGAATACAGAATGACTAGTGG + Intergenic
1175019423 20:55828575-55828597 ATGGAGCCCCGAATGACTTGTGG - Intergenic
1176596643 21:8704010-8704032 AGGGAATACAGAATGAATAGTGG - Intergenic
1180279562 22:10681452-10681474 AGGGAATACAGAATGAATAGTGG - Intergenic
1182918993 22:34062223-34062245 AGGGAGCACTGTAGGCCTTGTGG - Intergenic
1183587463 22:38761150-38761172 AAGGAGGACTGAATGAACTGGGG - Intronic
1185351855 22:50343616-50343638 AGGGGGCACTGACTGACTCGGGG - Intronic
1185351863 22:50343651-50343673 AGGGGGAACTGACTGACTGGGGG - Intronic
1185351887 22:50343717-50343739 AGGGGGCACTGACTGACTTGGGG - Intronic
1185352642 22:50346126-50346148 AGGGGGAACTGACTGACTTGGGG - Intronic
950235913 3:11320075-11320097 AGGGAACACGGAATGACTTGGGG - Intronic
960593514 3:119387959-119387981 AGTGAGACCTGAATGACATGGGG + Intronic
961074067 3:123965303-123965325 AGAGAGCACTAAATGGCTTGAGG - Intergenic
961309558 3:125986829-125986851 AGAGAGCACTAAATGGCTTGAGG + Intergenic
962573111 3:136731208-136731230 AGTGGGTAATGAATGCCTTGAGG - Intronic
965465848 3:169029847-169029869 AAGGACTACTGACTGATTTGTGG - Intergenic
965621342 3:170644938-170644960 AGGGAGGAGGGAAGGACTTGAGG - Intronic
970389993 4:15599213-15599235 AGGGAGTACTGAATGACTTGGGG - Intronic
970759526 4:19467859-19467881 AGGTATTACTTAGTGACTTGTGG + Intergenic
974195098 4:58563786-58563808 AGGAAGTACTGAATAACTATAGG + Intergenic
975188695 4:71434431-71434453 AGAGAGTGCTGAAAGACTTTGGG - Intronic
977242676 4:94592035-94592057 AGGGAGGACTGAAAGTCATGTGG + Intronic
977533182 4:98224579-98224601 TGGCAGTACTGCATGACTTCAGG - Intergenic
978485669 4:109251273-109251295 AGGGAATACAGAATGAGTGGTGG - Intronic
979552967 4:122011761-122011783 GGGAAGTACTGAATGAGGTGAGG - Intergenic
980728487 4:136797137-136797159 AGGGAACAATGAATGGCTTGTGG - Intergenic
981004512 4:139861288-139861310 AGGGAGAAGAGAATGAGTTGAGG - Intronic
982862058 4:160464412-160464434 AGTGAGTGCTGAATGTCTTCTGG - Intergenic
991349702 5:65708307-65708329 TGGAAGTACAGAATGGCTTGTGG - Intronic
993955960 5:94233609-94233631 ATGAAATACTGAATGAATTGTGG + Intronic
998187438 5:139992132-139992154 AGGGAGTACTTAATAAATTAAGG - Intronic
998784595 5:145695360-145695382 AAGGAGGCCTGAATGACTAGAGG + Intronic
1000286854 5:159834257-159834279 CCTGAGTTCTGAATGACTTGAGG - Intergenic
1000841514 5:166224732-166224754 AGGGTCTACTGAATTACTTCTGG - Intergenic
1001747547 5:174103325-174103347 AGGGAGTCATGGATGACTTCAGG + Intronic
1001833495 5:174809469-174809491 AGGGTGTTGTAAATGACTTGTGG - Intergenic
1002197806 5:177510559-177510581 AGGTGGTGCTGAATGACCTGAGG - Intronic
1003124715 6:3347111-3347133 TGGGGGTAGTTAATGACTTGGGG - Intronic
1014389246 6:120840686-120840708 AGGAAGTACTGAAAGAAGTGTGG + Intergenic
1017388311 6:153911188-153911210 AGGGAATACTGAATGGGTGGTGG - Intergenic
1017755664 6:157526943-157526965 CGGGAGCACTGAAGGACTTGGGG + Intronic
1020764592 7:12303971-12303993 AGGAAATTCTGAATGACTTGGGG - Intergenic
1022024764 7:26437212-26437234 AGGGAGTAATGAATGGCCTCTGG - Intergenic
1023479971 7:40623496-40623518 AGGGAGTATAAAATGATTTGTGG - Intronic
1023576243 7:41630505-41630527 AGGGAGAACTGTACCACTTGAGG + Intergenic
1024628447 7:51228329-51228351 AGGTAGCACTCAATGACTGGTGG + Intronic
1026187260 7:68091583-68091605 AGGGAAAACTGAATGACGGGAGG + Intergenic
1030381818 7:108820545-108820567 AGGGAGTACCAAAGGATTTGGGG - Intergenic
1030941916 7:115660973-115660995 AGGGTGGACTGCAGGACTTGAGG - Intergenic
1031667021 7:124496897-124496919 AGGGAGCACTTAATAATTTGTGG - Intergenic
1042162520 8:65911820-65911842 AGGGAGTGCACAATGACTAGAGG + Intergenic
1043512617 8:80964672-80964694 GGGAAGGCCTGAATGACTTGGGG - Intergenic
1045706872 8:104934176-104934198 AGATAGAACTGAGTGACTTGGGG - Intronic
1045815835 8:106274818-106274840 AGGGAATAGTGAAAGACCTGAGG + Intronic
1045880303 8:107030453-107030475 TAGGAGGACTGAATGATTTGGGG + Intergenic
1046176686 8:110584334-110584356 AGGGAGTAATGAAAGTATTGAGG + Intergenic
1048074101 8:131050053-131050075 ATAGAGTAATGAGTGACTTGGGG + Intergenic
1048628979 8:136219770-136219792 AGTGAGTAATGACTGACTTAAGG + Intergenic
1049784180 8:144442772-144442794 AGGGAGAGCTGAATGAGATGAGG - Exonic
1049848425 8:144817213-144817235 AGGGAGTACATAATCACTGGGGG - Intergenic
1053484753 9:38443278-38443300 AGGGAGGAGGGAATGACTTTGGG + Intergenic
1053695698 9:40637583-40637605 AGGGAATACAGAATGAATAGTGG - Intergenic
1053942688 9:43268626-43268648 AGGGAATACAGAATGAATAGTGG - Intergenic
1054306945 9:63436801-63436823 AGGGAATACAGAATGAATAGTGG - Intergenic
1054405676 9:64760789-64760811 AGGGAATACAGAATGAATAGTGG - Intergenic
1054439303 9:65246276-65246298 AGGGAATACAGAATGAATAGTGG - Intergenic
1054491104 9:65775663-65775685 AGGGAATACAGAATGAATAGTGG + Intergenic
1054730178 9:68693803-68693825 AGAGAGTACAGAATTACTTGTGG + Intergenic
1058371938 9:104279071-104279093 AGGGAGTAATAATTGTCTTGGGG + Intergenic
1061993588 9:134173184-134173206 AGGGAGTGCGGAATGACTTTGGG + Intergenic
1202778143 9_KI270717v1_random:11195-11217 AGGGAATACAGAATGAATAGTGG - Intergenic
1186404583 X:9290753-9290775 AGGGGGCACAGAATGAATTGGGG + Intergenic
1186497621 X:10024495-10024517 AGGGAGAACCGAATGGCTCGGGG - Intronic
1189756024 X:44271991-44272013 GCGGAGTTCTGAATGACTTCAGG - Intronic
1189858899 X:45252141-45252163 TAGGATTACAGAATGACTTGAGG - Intergenic
1190765967 X:53475872-53475894 AGGGAGTATGGAATGGCTAGTGG + Intergenic
1190991046 X:55550787-55550809 AAGAAATACTGAATGACTTCTGG - Intergenic
1192034583 X:67547988-67548010 AGGGAGGACAGACTGAATTGGGG + Intronic
1192896553 X:75448319-75448341 AGGGAGTACAGAATGGATGGTGG + Intronic
1193704060 X:84798963-84798985 AGGAAGTGCTGAAAGACTTTTGG - Intergenic
1195132048 X:101862748-101862770 AGGGACTACTGGCTGACTTCTGG + Intergenic
1195362704 X:104099922-104099944 AGGGAGTATTAAAAGATTTGAGG + Exonic
1195658789 X:107358677-107358699 AGGGAGGACTGGAAGACTGGAGG + Intergenic
1196056540 X:111362432-111362454 TGGGGGAACTGAATGGCTTGGGG - Intronic
1197259400 X:124301640-124301662 AGGTAGTAGTGAAGGAGTTGAGG - Intronic
1199894550 X:152117849-152117871 AGGTAGTACTGGATTATTTGGGG + Intergenic