ID: 970398908

View in Genome Browser
Species Human (GRCh38)
Location 4:15699536-15699558
Sequence CTCTTTCTGTTCCCAGTTTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2525
Summary {0: 5, 1: 83, 2: 160, 3: 868, 4: 1409}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
970398908_970398917 28 Left 970398908 4:15699536-15699558 CCTGAAACTGGGAACAGAAAGAG 0: 5
1: 83
2: 160
3: 868
4: 1409
Right 970398917 4:15699587-15699609 CTGGGGAGGCCTCAGAATCATGG 0: 927
1: 5460
2: 6455
3: 4087
4: 2288
970398908_970398914 10 Left 970398908 4:15699536-15699558 CCTGAAACTGGGAACAGAAAGAG 0: 5
1: 83
2: 160
3: 868
4: 1409
Right 970398914 4:15699569-15699591 ACTTACAGTTCTGCATGGCTGGG 0: 85
1: 1386
2: 5100
3: 8799
4: 8192
970398908_970398916 14 Left 970398908 4:15699536-15699558 CCTGAAACTGGGAACAGAAAGAG 0: 5
1: 83
2: 160
3: 868
4: 1409
Right 970398916 4:15699573-15699595 ACAGTTCTGCATGGCTGGGGAGG 0: 795
1: 2561
2: 7056
3: 8516
4: 6784
970398908_970398912 5 Left 970398908 4:15699536-15699558 CCTGAAACTGGGAACAGAAAGAG 0: 5
1: 83
2: 160
3: 868
4: 1409
Right 970398912 4:15699564-15699586 ATTGGACTTACAGTTCTGCATGG 0: 17
1: 121
2: 1640
3: 4524
4: 7631
970398908_970398913 9 Left 970398908 4:15699536-15699558 CCTGAAACTGGGAACAGAAAGAG 0: 5
1: 83
2: 160
3: 868
4: 1409
Right 970398913 4:15699568-15699590 GACTTACAGTTCTGCATGGCTGG 0: 84
1: 1310
2: 4824
3: 8328
4: 7987
970398908_970398915 11 Left 970398908 4:15699536-15699558 CCTGAAACTGGGAACAGAAAGAG 0: 5
1: 83
2: 160
3: 868
4: 1409
Right 970398915 4:15699570-15699592 CTTACAGTTCTGCATGGCTGGGG 0: 77
1: 1257
2: 4798
3: 8633
4: 8486

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
970398908 Original CRISPR CTCTTTCTGTTCCCAGTTTC AGG (reversed) Intronic
Too many off-targets to display for this crispr