ID: 970399100

View in Genome Browser
Species Human (GRCh38)
Location 4:15700884-15700906
Sequence TAGTAATTTTGGGGCATCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 80
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 75}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
970399100_970399108 2 Left 970399100 4:15700884-15700906 CCAGGGATGCCCCAAAATTACTA 0: 1
1: 0
2: 0
3: 4
4: 75
Right 970399108 4:15700909-15700931 CTAAAGGGAAAAGTCAGGCTGGG 0: 8
1: 309
2: 529
3: 493
4: 747
970399100_970399106 -3 Left 970399100 4:15700884-15700906 CCAGGGATGCCCCAAAATTACTA 0: 1
1: 0
2: 0
3: 4
4: 75
Right 970399106 4:15700904-15700926 CTAAACTAAAGGGAAAAGTCAGG 0: 2
1: 8
2: 13
3: 46
4: 228
970399100_970399110 14 Left 970399100 4:15700884-15700906 CCAGGGATGCCCCAAAATTACTA 0: 1
1: 0
2: 0
3: 4
4: 75
Right 970399110 4:15700921-15700943 GTCAGGCTGGGAACTGCTCAGGG 0: 1
1: 39
2: 383
3: 467
4: 611
970399100_970399107 1 Left 970399100 4:15700884-15700906 CCAGGGATGCCCCAAAATTACTA 0: 1
1: 0
2: 0
3: 4
4: 75
Right 970399107 4:15700908-15700930 ACTAAAGGGAAAAGTCAGGCTGG No data
970399100_970399109 13 Left 970399100 4:15700884-15700906 CCAGGGATGCCCCAAAATTACTA 0: 1
1: 0
2: 0
3: 4
4: 75
Right 970399109 4:15700920-15700942 AGTCAGGCTGGGAACTGCTCAGG 0: 1
1: 43
2: 389
3: 472
4: 565

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
970399100 Original CRISPR TAGTAATTTTGGGGCATCCC TGG (reversed) Intronic
906140080 1:43529172-43529194 TGGTAATTTTGGTGCACCACGGG - Intronic
908621112 1:65981068-65981090 TTGATATTTTGGGGCCTCCCAGG - Intronic
920246824 1:204594069-204594091 TACTACTTTTGTGGCATCCCAGG + Intergenic
922830334 1:228549863-228549885 TAGAAATTTTGGGGTCACCCAGG + Intergenic
924809131 1:247385910-247385932 TACTAATTGTGGAGAATCCCTGG - Intergenic
1063225839 10:4013900-4013922 AAGCCACTTTGGGGCATCCCAGG + Intergenic
1067221411 10:44346824-44346846 TAATAAGTTTGAGGCATCCTTGG + Intergenic
1069824761 10:71248177-71248199 TAGCAGTCTTGGGGCCTCCCTGG + Intronic
1073127021 10:101157482-101157504 AACTCATTTTGGGGGATCCCTGG + Intergenic
1073344225 10:102770112-102770134 TAATAATTTTGGGGAATGCAAGG - Intronic
1074481718 10:113828287-113828309 TAGTAATTTTGTGTTATACCTGG + Intergenic
1074798758 10:116977518-116977540 TTGGAATTTTGGGGCATCAGGGG + Intronic
1077013171 11:388520-388542 TGGTACTTTGGGGGCATCCTGGG + Intergenic
1078015473 11:7609714-7609736 TTGTAATTTTGGAACAGCCCAGG + Intronic
1078795633 11:14589754-14589776 TAGAAATCTTGAGGCATTCCTGG + Intronic
1084141330 11:67232038-67232060 TAGGAATTTTGGGTGATCTCTGG + Intronic
1086437364 11:86795499-86795521 TTTTAATTTTGGGGCACCCACGG - Intronic
1086983275 11:93221863-93221885 TAGAAAGTTTGGGGCAAGCCTGG - Intergenic
1088609999 11:111567789-111567811 TGGGACTTTTGGGGCAACCCTGG - Intergenic
1096762123 12:53850595-53850617 TAGGAATTTAGAGGAATCCCAGG + Intergenic
1100659792 12:96684408-96684430 TAGTAATAATGGGGCATCATGGG - Intronic
1100755075 12:97742433-97742455 TAGTAATACTGGAGCATACCAGG + Intergenic
1101224566 12:102675408-102675430 CAGTAAACTTGTGGCATCCCTGG + Intergenic
1103127724 12:118438698-118438720 TAGAAATTTAGAAGCATCCCTGG + Intergenic
1107102287 13:36606457-36606479 CAGCAATATTGGGGCAACCCTGG + Intergenic
1110770693 13:79341006-79341028 TAGTAATTGTTGGTAATCCCTGG - Intronic
1111927025 13:94474971-94474993 GAGAAATTTTGGATCATCCCAGG + Intronic
1122482709 14:102057809-102057831 TAGTGATTTTGGGGCACTCAAGG - Intergenic
1125911952 15:43448394-43448416 TAGTTATTTTGAGCCATCCCAGG - Intronic
1148187470 17:45655057-45655079 AAGCAAATTTGGGGCATCCGAGG - Intergenic
1162398201 19:10430217-10430239 CAGAGATTTGGGGGCATCCCTGG + Intronic
1167363813 19:49044381-49044403 CTGAAATTTTGGGGCATCTCAGG + Intronic
1168454410 19:56495132-56495154 TAGAAATCTTGAGGCATTCCTGG - Intergenic
930977346 2:57479325-57479347 TAGTTATTTGGGGGCAATCCTGG - Intergenic
931804614 2:65791924-65791946 AAGTAATTTTGTGGCATTTCTGG + Intergenic
932308092 2:70718058-70718080 TACTTATTTCTGGGCATCCCTGG + Intronic
935112575 2:100105806-100105828 TAGGAATTCTGGGGAATCCCTGG - Intronic
935249191 2:101246721-101246743 TAGTCATTTTGTGGCAGGCCAGG - Intronic
936841300 2:116773112-116773134 TAAAAATTATGGGGCATGCCAGG - Intergenic
940199663 2:151136583-151136605 TAAATATTTTGGGGCATCACAGG + Intergenic
948899427 2:240948833-240948855 TAGAAATTATGGTGCATCTCTGG - Intronic
1171327312 20:24305854-24305876 TAGAAGTTTGGGGGAATCCCAGG - Intergenic
1172857585 20:38017906-38017928 AAGTAAGTTTGGGGCTTACCAGG + Intronic
1173132678 20:40409345-40409367 TTGTATTTTTGGTGCAGCCCAGG - Intergenic
1179089715 21:38253283-38253305 TTTTAATTTTGTGGCTTCCCAGG + Intronic
1179935031 21:44598117-44598139 TAGTGATGTTGCGGCATGCCTGG - Intronic
1183857553 22:40645815-40645837 TAGTTTTATTGGGTCATCCCTGG + Intergenic
949132613 3:523072-523094 TAGTAACTTTGGTGGAGCCCAGG + Intergenic
949910114 3:8896791-8896813 TAGTATTTCTGTGGCATGCCAGG - Intronic
951974985 3:28495837-28495859 TAGTAATTTTGGAGAATACAAGG + Intronic
955789820 3:62577091-62577113 CAGCAATTTTGGGGGATTCCTGG - Intronic
960410643 3:117319676-117319698 TACTACTTTTGCTGCATCCCAGG - Intergenic
961125263 3:124411883-124411905 TACTTATTGTGGGGCATCCTTGG - Intronic
961155928 3:124679619-124679641 TTGTGATGTTGGGGCATCTCTGG + Intronic
961971309 3:130971565-130971587 TAGTAATTTTGGTGGGTTCCAGG - Intronic
963961295 3:151312151-151312173 TTGTAATTTTGGGGCCTAGCAGG + Intronic
965063504 3:163813083-163813105 CAATAATTTTGGGGCATAACAGG - Intergenic
967281575 3:187828608-187828630 TAGGAATTGTGCAGCATCCCAGG - Intergenic
970399100 4:15700884-15700906 TAGTAATTTTGGGGCATCCCTGG - Intronic
977041613 4:92025756-92025778 TAGTGATTTTGGGGCCTGTCAGG + Intergenic
978362903 4:107949745-107949767 AGGTAATTTTGGGGGGTCCCAGG + Intronic
992134611 5:73731534-73731556 CAGTAATTATGGGTCTTCCCTGG - Intronic
993988303 5:94624052-94624074 TAGTTATTTTGGGCCGTCACTGG + Intronic
996688824 5:126315289-126315311 TAATAATTTGGGGACATCTCTGG - Intergenic
997242851 5:132320729-132320751 TAGTAATTTTGCTGCTTCTCTGG + Intronic
1001878379 5:175220570-175220592 TAGTCATGTTGGGGCAGCCCCGG + Intergenic
1002347110 5:178555787-178555809 TAGTGACTCGGGGGCATCCCAGG - Intronic
1007296576 6:40826842-40826864 TGATAATTGTGGGGCATCCTGGG + Intergenic
1011261054 6:85469793-85469815 TTGTCATTCTGGGGCCTCCCTGG + Intronic
1012727459 6:102833219-102833241 TTGTAATTTTGGGGGGTGCCAGG + Intergenic
1013073725 6:106752151-106752173 TGGTATTTTGGCGGCATCCCTGG - Intergenic
1024023091 7:45388466-45388488 TATTTACTTTGGGGGATCCCTGG + Intergenic
1033795495 7:144840551-144840573 TAGTATATTTGGGGCTTCCAAGG - Intergenic
1035103888 7:156425527-156425549 TAATAACTTTGGGGAAACCCAGG + Intergenic
1036676350 8:10837181-10837203 CAGGAATTTTGGTGCCTCCCAGG + Intronic
1041621119 8:59970546-59970568 TAGAAATCTTGAGGCATTCCTGG - Intergenic
1060124217 9:121026562-121026584 TAGGAATTTAGCAGCATCCCCGG + Intronic
1060719192 9:125963459-125963481 TGGTAAGTTTGGAGAATCCCAGG + Intronic
1186536604 X:10356506-10356528 TCTTAACTTTGGAGCATCCCAGG - Intergenic
1195438890 X:104878633-104878655 AAGTAATTTTAGGGCCTCCTGGG + Intronic